View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_14_20 (Length: 86)

Name: 108_14_20
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_14_20
108_14_20
[»] chr7 (2 HSPs)
chr7 (1-47)||(29324803-29324849)
chr7 (49-83)||(29324848-29324882)


Alignment Details
Target: chr7 (Bit Score: 41; Significance: 0.000000000000007; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 47
Target Start/End: Complemental strand, 29324849 - 29324803
Alignment:
1 tcaangtcatcttgcctttcctacttcgctnattaaatatatgaatc 47  Q
    |||| ||||||||||||||||||||||||| ||||||||||||||||    
29324849 tcaacgtcatcttgcctttcctacttcgcttattaaatatatgaatc 29324803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000003
Query Start/End: Original strand, 49 - 83
Target Start/End: Complemental strand, 29324882 - 29324848
Alignment:
49 attcctttttcggtgcttttcctatttcgcttatc 83  Q
    |||||||||||||||||||||||||||||||||||    
29324882 attcctttttcggtgcttttcctatttcgcttatc 29324848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 315247 times since January 2019
Visitors: 446