View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_14_50 (Length: 249)

Name: 108_14_50
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_14_50
108_14_50
[»] chr1 (21 HSPs)
chr1 (1-167)||(9242584-9242750)
chr1 (1-167)||(9364294-9364460)
chr1 (1-167)||(9337435-9337601)
chr1 (9-164)||(9299994-9300149)
chr1 (162-249)||(9242501-9242588)
chr1 (162-249)||(9337597-9337684)
chr1 (162-249)||(9364456-9364543)
chr1 (25-164)||(9257577-9257716)
chr1 (8-164)||(9466785-9466941)
chr1 (162-249)||(9300153-9300240)
chr1 (162-249)||(9257470-9257557)
chr1 (1-164)||(8939277-8939440)
chr1 (162-246)||(9466695-9466779)
chr1 (1-164)||(8926851-8927014)
chr1 (1-164)||(8962204-8962367)
chr1 (162-231)||(8927028-8927097)
chr1 (45-170)||(8861889-8862014)
chr1 (101-170)||(9070055-9070124)
chr1 (162-231)||(8962381-8962450)
chr1 (169-249)||(10992814-10992894)
chr1 (28-56)||(9495286-9495314)
[»] scaffold0690 (2 HSPs)
scaffold0690 (1-167)||(1503-1669)
scaffold0690 (163-249)||(1665-1751)
[»] chr6 (2 HSPs)
chr6 (1-167)||(15910437-15910603)
chr6 (163-249)||(15910355-15910441)
[»] chr3 (2 HSPs)
chr3 (28-164)||(9171397-9171533)
chr3 (162-249)||(9171562-9171649)


Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 21)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 9242584 - 9242750
Alignment:
1 aggaaatcatctttgttgtttgggggagaaatgaatttctgcaacgaaccatttgggaaaaattcatagactaaagcacggcgaaatccatccgcgcagt 100  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
9242584 aggaaatcatctttgttgtttggggaagaaatgaatttctgcaacgaaccatttgggaaaaagtcatagactaaagcacggcgaaatccatccgcgcagt 9242683  T
101 agccaagcaaacgaacgacatttagatggtgaattttgcccatggttcccacttcatttatgaattc 167  Q
    |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||    
9242684 agccaagcaaacgaacgacatttagatgatgaatcttgcccatggttcccacttcatttatgaattc 9242750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 9364460 - 9364294
Alignment:
1 aggaaatcatctttgttgtttgggggagaaatgaatttctgcaacgaaccatttgggaaaaattcatagactaaagcacggcgaaatccatccgcgcagt 100  Q
    ||||||||||||||| |||| | ||||||||||||||||||||||||||||||||  ||||| ||||||||||||||||| ||||| ||||| ||||||     
9364460 aggaaatcatctttgctgttcgcgggagaaatgaatttctgcaacgaaccatttgaaaaaaagtcatagactaaagcacgacgaaaaccatctgcgcaga 9364361  T
101 agccaagcaaacgaacgacatttagatggtgaattttgcccatggttcccacttcatttatgaattc 167  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
9364360 agccaagcaaacgaacgacattgagatggtgaattttgcccatggttcccacttcatttatgaattc 9364294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 9337601 - 9337435
Alignment:
1 aggaaatcatctttgttgtttgggggagaaatgaatttctgcaacgaaccatttgggaaaaattcatagactaaagcacggcgaaatccatccgcgcagt 100  Q
    ||||||||||||||| |||| | ||||||||||||||||||||||||||||||||  ||||| ||||||||||||||||| ||||| ||||| ||||||     
9337601 aggaaatcatctttgctgttcgcgggagaaatgaatttctgcaacgaaccatttgaaaaaaagtcatagactaaagcacgacgaaaaccatctgcgcaga 9337502  T
101 agccaagcaaacgaacgacatttagatggtgaattttgcccatggttcccacttcatttatgaattc 167  Q
    |||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
9337501 agccgagcaaacgaacgacattgagatggtgaattttgcccatggttcccacttcatttatgaattc 9337435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 9 - 164
Target Start/End: Complemental strand, 9300149 - 9299994
Alignment:
9 atctttgttgtttgggggagaaatgaatttctgcaacgaaccatttgggaaaaattcatagactaaagcacggcgaaatccatccgcgcagtagccaagc 108  Q
    |||||||||| | || ||||||||||||||||||||||||||| ||||||| || |||||||||| ||||||  |||||||||| || ||  ||||||||    
9300149 atctttgttgctaggaggagaaatgaatttctgcaacgaaccacttgggaagaagtcatagactagagcacgatgaaatccatcggcacaaaagccaagc 9300050  T
109 aaacgaacgacatttagatggtgaattttgcccatggttcccacttcatttatgaa 164  Q
    ||||| || ||||| |||||||| ||||||||||| ||||||||||||||||||||    
9300049 aaacggacaacattgagatggtggattttgcccattgttcccacttcatttatgaa 9299994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 162 - 249
Target Start/End: Original strand, 9242501 - 9242588
Alignment:
162 gaattctttgatcacaaccttggtggagatactcnatgccatttgctatacctagagcaattttttgcaacttatcccatccaaggaa 249  Q
    |||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||    
9242501 gaattctttgatcacaaccttggtggagatactcaatgccattggctatacctagagcaattttttgcaacttatcccatccaaggaa 9242588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 162 - 249
Target Start/End: Complemental strand, 9337684 - 9337597
Alignment:
162 gaattctttgatcacaaccttggtggagatactcnatgccatttgctatacctagagcaattttttgcaacttatcccatccaaggaa 249  Q
    |||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||    
9337684 gaattctttgatcacaaccttggtggagatactcaataccatttgctatgcctagagcaattttttgcaacttatcccatccaaggaa 9337597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 162 - 249
Target Start/End: Complemental strand, 9364543 - 9364456
Alignment:
162 gaattctttgatcacaaccttggtggagatactcnatgccatttgctatacctagagcaattttttgcaacttatcccatccaaggaa 249  Q
    |||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||    
9364543 gaattctttgatcacaaccttggtggagatactcaataccatttgctatgcctagagcaattttttgcaacttatcccatccaaggaa 9364456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 25 - 164
Target Start/End: Original strand, 9257577 - 9257716
Alignment:
25 ggagaaatgaatttctgcaacgaaccatttgggaaaaattcatagactaaagcacggcgaaatccatccgcgcagtagccaagcaaacgaacgacattta 124  Q
    ||||||||||||||||||||||||||||||||||| || |||||||||| ||||||  |||||||||| || ||  |||||||||| || ||  |||| |    
9257577 ggagaaatgaatttctgcaacgaaccatttgggaagaagtcatagactagagcacgatgaaatccatcggcacaaaagccaagcaagcggacagcattga 9257676  T
125 gatggtgaattttgcccatggttcccacttcatttatgaa 164  Q
    ||||||| ||||| ||||| ||||||||||||||||||||    
9257677 gatggtggattttacccatagttcccacttcatttatgaa 9257716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 8 - 164
Target Start/End: Original strand, 9466785 - 9466941
Alignment:
8 catctttgttgtttgggggagaaatgaatttctgcaacgaaccatttgggaaaaattcatagactaaagcacggcgaaatccatccgcgcagtagccaag 107  Q
    |||||||||||||||| |||||||  ||||||||||| |||||| |||| ||||  || ||||||||| | |||  ||||||||| |||||| |||||||    
9466785 catctttgttgtttggtggagaaagaaatttctgcaaagaaccacttggaaaaagatcgtagactaaaccgcggtaaaatccatcagcgcagaagccaag 9466884  T
108 caaacgaacgacatttagatggtgaattttgcccatggttcccacttcatttatgaa 164  Q
    |||||| || ||||| ||||| || ||||| ||||| ||||||||||||||||||||    
9466885 caaacggacaacattaagatgatggatttttcccatagttcccacttcatttatgaa 9466941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 162 - 249
Target Start/End: Complemental strand, 9300240 - 9300153
Alignment:
162 gaattctttgatcacaaccttggtggagatactcnatgccatttgctatacctagagcaattttttgcaacttatcccatccaaggaa 249  Q
    ||||||||||||||||||||||||| |||||||| || ||||| ||||| ||||||||||||| ||||||||||||||||||||||||    
9300240 gaattctttgatcacaaccttggtgaagatactctattccattggctatgcctagagcaatttgttgcaacttatcccatccaaggaa 9300153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 162 - 249
Target Start/End: Original strand, 9257470 - 9257557
Alignment:
162 gaattctttgatcacaaccttggtggagatactcnatgccatttgctatacctagagcaattttttgcaacttatcccatccaaggaa 249  Q
    |||||||||||||||||| |||||| |||||||| || ||||| ||||| ||||||||||||| ||||||||| ||||||||||||||    
9257470 gaattctttgatcacaactttggtgaagatactcgattccattggctatgcctagagcaatttgttgcaacttgtcccatccaaggaa 9257557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 8939440 - 8939277
Alignment:
1 aggaaatcatctttgttgtttgggggagaaatgaatttctgcaacgaaccatttgggaaaaattcatagactaaagcacggcgaaatccatccgcgcagt 100  Q
    |||||| |||| |||||||  || | ||||||||| || ||||| ||||||||||||||||| ||||| || ||||||||   ||||||||| || ||      
8939440 aggaaaacatccttgttgtcaggtgaagaaatgaaattttgcaatgaaccatttgggaaaaagtcataaaccaaagcacgataaaatccatcggcacaaa 8939341  T
101 agccaagcaaacgaacgacatttagatggtgaattttgcccatggttcccacttcatttatgaa 164  Q
    |||||||||| || || ||||| | ||| |||||||| ||||| ||||||||||||||||||||    
8939340 agccaagcaaccggacaacattaacatgatgaatttttcccatagttcccacttcatttatgaa 8939277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 162 - 246
Target Start/End: Original strand, 9466695 - 9466779
Alignment:
162 gaattctttgatcacaaccttggtggagatactcnatgccatttgctatacctagagcaattttttgcaacttatcccatccaag 246  Q
    ||||||||||||||||||||||||| |||||||| || ||||| ||||| ||||||||||||| ||||| | | |||||||||||    
9466695 gaattctttgatcacaaccttggtgaagatactcaattccattggctatgcctagagcaatttgttgcagcgtgtcccatccaag 9466779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 8927014 - 8926851
Alignment:
1 aggaaatcatctttgttgtttgggggagaaatgaatttctgcaacgaaccatttgggaaaaattcatagactaaagcacggcgaaatccatccgcgcagt 100  Q
    |||||| |||| |||||||  || | ||||||||| || |||||||||||||| |||||||| ||||| || | ||||||   ||||||||| || ||      
8927014 aggaaaacatccttgttgtcgggtgaagaaatgaagttttgcaacgaaccattcgggaaaaagtcataaaccagagcacgataaaatccatcggcacaaa 8926915  T
101 agccaagcaaacgaacgacatttagatggtgaattttgcccatggttcccacttcatttatgaa 164  Q
    |||||||||| ||||| ||||| | ||| || ||||| ||||| |||||||| |||||||||||    
8926914 agccaagcaaccgaacaacattaacatgatggatttttcccatagttcccacctcatttatgaa 8926851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 8962367 - 8962204
Alignment:
1 aggaaatcatctttgttgtttgggggagaaatgaatttctgcaacgaaccatttgggaaaaattcatagactaaagcacggcgaaatccatccgcgcagt 100  Q
    |||||| |||| |||||||  || | ||||||||| || |||||||||||||| |||||||| ||||| || ||||||||   ||||||||| |||||      
8962367 aggaaaacatccttgttgtcaggtgaagaaatgaaattttgcaacgaaccattagggaaaaagtcataaaccaaagcacgataaaatccatcagcgcaaa 8962268  T
101 agccaagcaaacgaacgacatttagatggtgaattttgcccatggttcccacttcatttatgaa 164  Q
    ||||||| || || || ||||| | ||| || ||||| ||||| ||||| ||||||||||||||    
8962267 agccaagtaaccggacaacattaacatgatggatttttcccatagttcctacttcatttatgaa 8962204  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 162 - 231
Target Start/End: Complemental strand, 8927097 - 8927028
Alignment:
162 gaattctttgatcacaaccttggtggagatactcnatgccatttgctatacctagagcaattttttgcaa 231  Q
    ||||||| ||||||||||||||||| |||||||| || ||||| || || ||||||||||||| ||||||    
8927097 gaattctatgatcacaaccttggtgaagatactcaatcccattggcaatgcctagagcaatttgttgcaa 8927028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 45 - 170
Target Start/End: Original strand, 8861889 - 8862014
Alignment:
45 cgaaccatttgggaaaaattcatagactaaagcacggcgaaatccatccgcgcagtagccaagcaaacgaacgacatttagatggtgaattttgcccatg 144  Q
    |||||||||||| || || |  ||||| | ||| ||| ||| |||||| |||||| |||||||||||||||| || || |  ||||| |||||||||||     
8861889 cgaaccatttggaaataaattgtagacaagagcgcggtgaattccatctgcgcagaagccaagcaaacgaaccacgttgatgtggtggattttgcccata 8861988  T
145 gttcccacttcatttatgaattcttt 170  Q
     ||||||||||||| ||||| |||||    
8861989 attcccacttcattgatgaactcttt 8862014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 101 - 170
Target Start/End: Original strand, 9070055 - 9070124
Alignment:
101 agccaagcaaacgaacgacatttagatggtgaattttgcccatggttcccacttcatttatgaattcttt 170  Q
    |||||||||||||||| ||||| | ||||||||||||||||||  || |||||||| | ||||| |||||    
9070055 agccaagcaaacgaaccacattgatatggtgaattttgcccataatttccacttcagtgatgaactcttt 9070124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 162 - 231
Target Start/End: Complemental strand, 8962450 - 8962381
Alignment:
162 gaattctttgatcacaaccttggtggagatactcnatgccatttgctatacctagagcaattttttgcaa 231  Q
    |||||||||||||||| || ||||| |||||||| || ||||| || || ||||||||||| | ||||||    
8962450 gaattctttgatcacagccctggtgaagatactcaattccattggcaatgcctagagcaatctgttgcaa 8962381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 169 - 249
Target Start/End: Complemental strand, 10992894 - 10992814
Alignment:
169 ttgatcacaaccttggtggagatactcnatgccatttgctatacctagagcaattttttgcaacttatcccatccaaggaa 249  Q
    ||||||||||||||| || |||||||| |  || || |||||||||| ||||||||  |||||||| | ||| ||||||||    
10992894 ttgatcacaaccttgatgaagatactcaactcctttagctatacctaaagcaatttcatgcaactttttccaaccaaggaa 10992814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 28 - 56
Target Start/End: Complemental strand, 9495314 - 9495286
Alignment:
28 gaaatgaatttctgcaacgaaccatttgg 56  Q
    |||||||||||||||||||||||||||||    
9495314 gaaatgaatttctgcaacgaaccatttgg 9495286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0690 (Bit Score: 107; Significance: 9e-54; HSPs: 2)
Name: scaffold0690
Description:

Target: scaffold0690; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 167
Target Start/End: Complemental strand, 1669 - 1503
Alignment:
1 aggaaatcatctttgttgtttgggggagaaatgaatttctgcaacgaaccatttgggaaaaattcatagactaaagcacggcgaaatccatccgcgcagt 100  Q
    ||||||||||||||||||||  || |||| ||||||||||| |||||||||||||| ||||| ||||| ||||||||||| ||||| ||||| |||||      
1669 aggaaatcatctttgttgttcaggtgagatatgaatttctgtaacgaaccatttggaaaaaagtcataaactaaagcacgacgaaaaccatctgcgcaaa 1570  T
101 agccaagcaaacgaacgacatttagatggtgaattttgcccatggttcccacttcatttatgaattc 167  Q
    |||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||    
1569 agccaagcaaacgaacgacattgagatggtggattttgcccatggttcccacttcatttatgaattc 1503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0690; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 163 - 249
Target Start/End: Complemental strand, 1751 - 1665
Alignment:
163 aattctttgatcacaaccttggtggagatactcnatgccatttgctatacctagagcaattttttgcaacttatcccatccaaggaa 249  Q
    ||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||| |||||| |||||||||||||||||    
1751 aattctttgatcacaaccttggtggagatactcaatgccattagctatgcctagagcaatttgttgcaatttatcccatccaaggaa 1665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 167
Target Start/End: Original strand, 15910437 - 15910603
Alignment:
1 aggaaatcatctttgttgtttgggggagaaatgaatttctgcaacgaaccatttgggaaaaattcatagactaaagcacggcgaaatccatccgcgcagt 100  Q
    |||||||||||||||||||| ||| |||| |||||||| || |||||||||||||| ||||| ||||| |||||||||||  |||| ||||| | |||      
15910437 aggaaatcatctttgttgttcgggtgagatatgaatttttgtaacgaaccatttggaaaaaagtcataaactaaagcacgatgaaaaccatctgagcaaa 15910536  T
101 agccaagcaaacgaacgacatttagatggtgaattttgcccatggttcccacttcatttatgaattc 167  Q
    |||| ||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||    
15910537 agccgagcaaacgaacgacattgagatggtggattttgcccatggttcccacttcatttatgaattc 15910603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 163 - 249
Target Start/End: Original strand, 15910355 - 15910441
Alignment:
163 aattctttgatcacaaccttggtggagatactcnatgccatttgctatacctagagcaattttttgcaacttatcccatccaaggaa 249  Q
    ||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||||||||| |||||| |||||||||||||||||    
15910355 aattctttgatcacaaccttggtggagatactcaatgccattagctatgcctagagcaatttgttgcaatttatcccatccaaggaa 15910441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 89; Significance: 5e-43; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 28 - 164
Target Start/End: Complemental strand, 9171533 - 9171397
Alignment:
28 gaaatgaatttctgcaacgaaccatttgggaaaaattcatagactaaagcacggcgaaatccatccgcgcagtagccaagcaaacgaacgacatttagat 127  Q
    ||||||||||||||||| ||||||||||||||||| |||||||||| ||||||  |||||||||| |||||  ||||||||||||| || ||||||||||    
9171533 gaaatgaatttctgcaaagaaccatttgggaaaaaatcatagactagagcacgatgaaatccatcggcgcaaaagccaagcaaacggacaacatttagat 9171434  T
128 ggtgaattttgcccatggttcccacttcatttatgaa 164  Q
    |||| ||||||||||| ||||||||||||||||||||    
9171433 ggtggattttgcccatagttcccacttcatttatgaa 9171397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 162 - 249
Target Start/End: Complemental strand, 9171649 - 9171562
Alignment:
162 gaattctttgatcacaaccttggtggagatactcnatgccatttgctatacctagagcaattttttgcaacttatcccatccaaggaa 249  Q
    ||||||||||||||||||||||||| |||||||| || ||||| ||||| ||||||||||||| ||||||||| ||||||| ||||||    
9171649 gaattctttgatcacaaccttggtgcagatactcaattccattggctattcctagagcaatttgttgcaacttgtcccatctaaggaa 9171562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108097 times since January 2019
Visitors: 1329