View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_14_71 (Length: 444)

Name: 108_14_71
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_14_71
108_14_71
[»] chr1 (2 HSPs)
chr1 (202-444)||(8310149-8310391)
chr1 (1-115)||(8309963-8310077)
[»] chr8 (2 HSPs)
chr8 (218-345)||(30411785-30411914)
chr8 (28-115)||(27662957-27663044)


Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 202 - 444
Target Start/End: Original strand, 8310149 - 8310391
Alignment:
202 gcagtttgcaagctgcaaggaaacgtttactgttcttatgatttacatcactgaagttgattaatgatctgaaaacgtgattcctcacaaatacatgatc 301  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8310149 gcagtttgcaagctgcaaggaaacgtttactgttcttatgatttaaatcactgaagttgattaatgatctgaaaacgtgattcctcacaaatacatgatc 8310248  T
302 aacaactagtgatttccacatcttagaaatgcacatcaattcaactggattatctgaatcaattcttgatatgatatggatcaatagttcatgcgggagt 401  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8310249 aacaactagtgatttccacatcttagaaatgcacatcaattcaactggattatctgaatcaattcttgatatgatatggatcaatagttcatgcgggagt 8310348  T
402 tcttgaaatgataccgccgttgttgcttcctccatcgtgcaat 444  Q
    |||||||||||||||||||||||||||||||||||||||||||    
8310349 tcttgaaatgataccgccgttgttgcttcctccatcgtgcaat 8310391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 1 - 115
Target Start/End: Original strand, 8309963 - 8310077
Alignment:
1 ccaatgccgtataaatcttaatgatcatagcagcattgtttatcgcccattgatccacttcttcttcatcaagattatcccgctcagccaaccatttcac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8309963 ccaatgccgtataaatcttaatgatcatagcagcattgtttatcgcccattgatccacttcttcttcatcaagattatcccgctcagccaaccatttcac 8310062  T
101 cataaattgtttctc 115  Q
    |||||||||||||||    
8310063 cataaattgtttctc 8310077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 67; Significance: 1e-29; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 218 - 345
Target Start/End: Original strand, 30411785 - 30411914
Alignment:
218 aaggaaacgtttactgt--tcttatgatttacatcactgaagttgattaatgatctgaaaacgtgattcctcacaaatacatgatcaacaactagtgatt 315  Q
    |||||| ||||||||||  ||||||||||||||||||||||||   ||||   |||| ||| ||||||||||||||||||||||||||||||||||||||    
30411785 aaggaagcgtttactgtgttcttatgatttacatcactgaagtcagttaacattctggaaaggtgattcctcacaaatacatgatcaacaactagtgatt 30411884  T
316 tccacatcttagaaatgcacatcaattcaa 345  Q
    |||||| |||| |||||||| |||| ||||    
30411885 tccacaacttacaaatgcacctcaaatcaa 30411914  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 28 - 115
Target Start/End: Original strand, 27662957 - 27663044
Alignment:
28 tagcagcattgtttatcgcccattgatccacttcttcttcatcaagattatcccgctcagccaaccatttcaccataaattgtttctc 115  Q
    |||| |||||||||||||||||| | | |  |||||||||||||| ||||| |||||||| |||| | |||| |||||||||||||||    
27662957 tagctgcattgtttatcgcccatcgtttcctttcttcttcatcaaaattattccgctcaggcaacaagttcatcataaattgtttctc 27663044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111029 times since January 2019
Visitors: 1335