View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_15_49 (Length: 296)

Name: 108_15_49
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_15_49
108_15_49
[»] chr4 (2 HSPs)
chr4 (4-260)||(16060660-16060916)
chr4 (256-293)||(16060621-16060658)


Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 4 - 260
Target Start/End: Original strand, 16060660 - 16060916
Alignment:
4 ataaggatgaatagatgtttggtcttgttttctgttattattattctacgaagtagttgattttgtgtattgttgatttgcattttgtacacaattttga 103  Q
    ||||||| ||||||||||||||||||| ||||| || || |||||||| |||| ||||||||||||||||||| ||||||||||||||||||||||||||    
16060660 ataaggacgaatagatgtttggtcttgctttcttttgtttttattctatgaagaagttgattttgtgtattgtagatttgcattttgtacacaattttga 16060759  T
104 tatatgtgaaatggcttcatcgtttgattattgcagatcaccatggttctgctaaagttgcctgctggaaagacccaatgagtccttctaaatggaagga 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||    
16060760 tatatgtgaaatggcttcatcgtttgattattgcagatcaccatggttccgctaaagttgcctgctggaaagacccaatgagtccttctaaatggaagga 16060859  T
204 agagcacgtgagtctctagttttgtgtttgaagatcaactctaacgaacttgaattg 260  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
16060860 agagcacgtgagtctctagttttgtgtttgaagatcaactctaacgaacttgaattg 16060916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 293
Target Start/End: Original strand, 16060621 - 16060658
Alignment:
256 aattgactttggttttggatagattaatggactaatga 293  Q
    ||||||||||||||||||||||||||||||||||||||    
16060621 aattgactttggttttggatagattaatggactaatga 16060658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175916 times since January 2019
Visitors: 1577