View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 108_15_49 (Length: 296)
Name: 108_15_49
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 108_15_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 4 - 260
Target Start/End: Original strand, 16060660 - 16060916
Alignment:
Q |
4 |
ataaggatgaatagatgtttggtcttgttttctgttattattattctacgaagtagttgattttgtgtattgttgatttgcattttgtacacaattttga |
103 |
Q |
|
|
||||||| ||||||||||||||||||| ||||| || || |||||||| |||| ||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
16060660 |
ataaggacgaatagatgtttggtcttgctttcttttgtttttattctatgaagaagttgattttgtgtattgtagatttgcattttgtacacaattttga |
16060759 |
T |
 |
Q |
104 |
tatatgtgaaatggcttcatcgtttgattattgcagatcaccatggttctgctaaagttgcctgctggaaagacccaatgagtccttctaaatggaagga |
203 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16060760 |
tatatgtgaaatggcttcatcgtttgattattgcagatcaccatggttccgctaaagttgcctgctggaaagacccaatgagtccttctaaatggaagga |
16060859 |
T |
 |
Q |
204 |
agagcacgtgagtctctagttttgtgtttgaagatcaactctaacgaacttgaattg |
260 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16060860 |
agagcacgtgagtctctagttttgtgtttgaagatcaactctaacgaacttgaattg |
16060916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 256 - 293
Target Start/End: Original strand, 16060621 - 16060658
Alignment:
Q |
256 |
aattgactttggttttggatagattaatggactaatga |
293 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| |
|
|
T |
16060621 |
aattgactttggttttggatagattaatggactaatga |
16060658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 175916 times since January 2019
Visitors: 1577