View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_15_82 (Length: 128)

Name: 108_15_82
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_15_82
108_15_82
[»] chr4 (1 HSPs)
chr4 (15-128)||(19633209-19633322)


Alignment Details
Target: chr4 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 15 - 128
Target Start/End: Complemental strand, 19633322 - 19633209
Alignment:
15 aattaatattgttatatcatttgcgaataatacctttccataacaatagataaagtataatgatatttagtgatgctaggtatccttgaagaattgcgaa 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19633322 aattaatattgttatatcatttgcgaataatacctttccataacaatagataaagtataatgatatttagtgatgctaggtatccttgaagaattgcgaa 19633223  T
115 taatttatctaata 128  Q
    ||||||||||||||    
19633222 taatttatctaata 19633209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 310199 times since January 2019
Visitors: 444