View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_15_88 (Length: 305)

Name: 108_15_88
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_15_88
108_15_88
[»] chr3 (4 HSPs)
chr3 (1-180)||(3881972-3882151)
chr3 (1-174)||(39317241-39317414)
chr3 (182-278)||(3882147-3882243)
chr3 (181-278)||(39317148-39317245)
[»] chr1 (2 HSPs)
chr1 (1-180)||(14011776-14011955)
chr1 (182-278)||(14011684-14011780)


Alignment Details
Target: chr3 (Bit Score: 176; Significance: 8e-95; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 3882151 - 3881972
Alignment:
1 gtcaggagatggacaaaacctataggttcctgaacttgaggctacaaaagctcccaaagaagccctgaaaagttcttccaacttatcatttgacaggaga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3882151 gtcaggagatggacaaaacctataggttcctgaacttgaggctacaaaagctcccaaagaagccctgaaaagttcttccaacttatcatttgacaggaga 3882052  T
101 gttctgaaatctacaagcaaaatatgatttccacagccttgatgagcacaacgtattgggaaactgccttggttttttat 180  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
3882051 gttctgaaatctacaagcaaaatatgatttccacagccctgatgagcacaacgtattgggaaactgccttggttttttat 3881972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 1 - 174
Target Start/End: Original strand, 39317241 - 39317414
Alignment:
1 gtcaggagatggacaaaacctataggttcctgaacttgaggctacaaaagctcccaaagaagccctgaaaagttcttccaacttatcatttgacaggaga 100  Q
    ||||||||| || ||||||||||| ||||| ||||| || ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
39317241 gtcaggagacgggcaaaacctataagttcccgaactcgaagctacaaaagctcccaaagaagccctgaaaagttcgtccaacttatcatttgacaggaga 39317340  T
101 gttctgaaatctacaagcaaaatatgatttccacagccttgatgagcacaacgtattgggaaactgccttggtt 174  Q
    ||||| ||||||  |||||||||| ||| |||||||||||| |||||||| | |||||||||||||||||||||    
39317341 gttctaaaatctgtaagcaaaataggatctccacagccttggtgagcacagcatattgggaaactgccttggtt 39317414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 182 - 278
Target Start/End: Complemental strand, 3882243 - 3882147
Alignment:
182 tggcacctggtacaagtctctgaataacataccccacaaacaaatggcgcactagctgngtcgggatctgcaactctatagattgaggggnagtcag 278  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||    
3882243 tggcacctggtacaagtctctgaataacatgccccacaaacaaatggcgcactagctgtgtcgggatctgcaactctatagattgaggggcagtcag 3882147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 181 - 278
Target Start/End: Original strand, 39317148 - 39317245
Alignment:
181 gtggcacctggtacaagtctctgaataacataccccacaaacaaatggcgcactagctgngtcgggatctgcaactctatagattgaggggnagtcag 278  Q
    ||||||| ||||||| ||||||||||||||| ||||||||||||||||| ||||||||| ||||| ||||||||||| ||| | ||| ||| ||||||    
39317148 gtggcacttggtacatgtctctgaataacatgccccacaaacaaatggctcactagctgtgtcggaatctgcaactcgataaactgaagggcagtcag 39317245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 176; Significance: 8e-95; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 1 - 180
Target Start/End: Original strand, 14011776 - 14011955
Alignment:
1 gtcaggagatggacaaaacctataggttcctgaacttgaggctacaaaagctcccaaagaagccctgaaaagttcttccaacttatcatttgacaggaga 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14011776 gtcaggagatggacaaaacctataggttcctgaacttgaggctacaaaagctcccaaagaagccctgaaaagttcttccaacttatcatttgacaggaga 14011875  T
101 gttctgaaatctacaagcaaaatatgatttccacagccttgatgagcacaacgtattgggaaactgccttggttttttat 180  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
14011876 gttctgaaatctacaagcaaaatatgatttccacagccctgatgagcacaacgtattgggaaactgccttggttttttat 14011955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 182 - 278
Target Start/End: Original strand, 14011684 - 14011780
Alignment:
182 tggcacctggtacaagtctctgaataacataccccacaaacaaatggcgcactagctgngtcgggatctgcaactctatagattgaggggnagtcag 278  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||  ||||||||| ||||||||||||||||||||||||||||||| ||||||    
14011684 tggcacctggtacaagtctctgaataacatgccccacaaacaaatggaacactagctgtgtcgggatctgcaactctatagattgaggggcagtcag 14011780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110758 times since January 2019
Visitors: 1335