View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_16_12 (Length: 357)

Name: 108_16_12
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_16_12
108_16_12
[»] chr7 (3 HSPs)
chr7 (1-207)||(19822442-19822648)
chr7 (269-357)||(19822358-19822446)
chr7 (229-274)||(19823783-19823828)
[»] chr4 (1 HSPs)
chr4 (273-352)||(30864154-30864232)
[»] chr2 (2 HSPs)
chr2 (200-233)||(23189902-23189935)
chr2 (200-233)||(23611157-23611190)
[»] chr3 (1 HSPs)
chr3 (195-231)||(102-138)


Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 19822442 - 19822648
Alignment:
1 taaagatctcatattttcttccataatgacataattattgtcattagagtaaagttgtgttagtttaacttatttcagcacatcaaatatatgtttttgt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19822442 taaagatctcatattttcttccataatgacataattattgtcattagagtaaagttgtgttagtttaacttatttcagcacatcaaatatatgtttttgt 19822541  T
101 gcaacaatgatggtaaagttaagacttttgttgatggtaaatcccctctcttctttcttcaagcaatatgagctttttggtggagctgtgattatttaag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19822542 gcaacaatgatggtaaagttaagacttttgttgatggtaaatcccctctcttctttcttcaagcaatatgagctttttggtggagctgtgattatttaag 19822641  T
201 tttaagg 207  Q
    |||||||    
19822642 tttaagg 19822648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 269 - 357
Target Start/End: Original strand, 19822358 - 19822446
Alignment:
269 attaatttttgtctgatttgtgttaattttggtcgacaatgttgttgcaagtgtcctcttttgatcttttgttgttgcagaggataaag 357  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19822358 attaatttttgtctgatttgtgttaattttggtcgacaatgttgttgcaagtgtcctcttttgatcttttgttgttgcagaggataaag 19822446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 229 - 274
Target Start/End: Original strand, 19823783 - 19823828
Alignment:
229 tttgtcgtcgtgttcaatttctctccttttctgaacttgtattaat 274  Q
    |||||||||||||||||||||||||||||||||||||| |||||||    
19823783 tttgtcgtcgtgttcaatttctctccttttctgaacttctattaat 19823828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 273 - 352
Target Start/End: Original strand, 30864154 - 30864232
Alignment:
273 atttttgtctgatttgtgttaattttggtcgacaatgttgttgcaagtgtcctcttttgatcttttgttgttgcagagga 352  Q
    |||||||| ||||||  |||||||||| || |||||||||||  ||| ||||||||||||| ||||| |||| |||||||    
30864154 atttttgt-tgattttggttaattttgatcaacaatgttgttttaagcgtcctcttttgattttttgctgtttcagagga 30864232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 233
Target Start/End: Complemental strand, 23189935 - 23189902
Alignment:
200 gtttaaggtttagggtttagggtttagggtttgt 233  Q
    ||||| ||||||||||||||||||||||||||||    
23189935 gtttagggtttagggtttagggtttagggtttgt 23189902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 233
Target Start/End: Complemental strand, 23611190 - 23611157
Alignment:
200 gtttaaggtttagggtttagggtttagggtttgt 233  Q
    ||||| ||||||||||||||||||||||||||||    
23611190 gtttagggtttagggtttagggtttagggtttgt 23611157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 231
Target Start/End: Complemental strand, 138 - 102
Alignment:
195 tttaagtttaaggtttagggtttagggtttagggttt 231  Q
    |||| ||||| ||||||||||||||||||||||||||    
138 tttaggtttagggtttagggtttagggtttagggttt 102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175465 times since January 2019
Visitors: 1577