View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 108_16_12 (Length: 357)
Name: 108_16_12
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 108_16_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 207; Significance: 1e-113; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 19822442 - 19822648
Alignment:
Q |
1 |
taaagatctcatattttcttccataatgacataattattgtcattagagtaaagttgtgttagtttaacttatttcagcacatcaaatatatgtttttgt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19822442 |
taaagatctcatattttcttccataatgacataattattgtcattagagtaaagttgtgttagtttaacttatttcagcacatcaaatatatgtttttgt |
19822541 |
T |
 |
Q |
101 |
gcaacaatgatggtaaagttaagacttttgttgatggtaaatcccctctcttctttcttcaagcaatatgagctttttggtggagctgtgattatttaag |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19822542 |
gcaacaatgatggtaaagttaagacttttgttgatggtaaatcccctctcttctttcttcaagcaatatgagctttttggtggagctgtgattatttaag |
19822641 |
T |
 |
Q |
201 |
tttaagg |
207 |
Q |
|
|
||||||| |
|
|
T |
19822642 |
tttaagg |
19822648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 89; E-Value: 8e-43
Query Start/End: Original strand, 269 - 357
Target Start/End: Original strand, 19822358 - 19822446
Alignment:
Q |
269 |
attaatttttgtctgatttgtgttaattttggtcgacaatgttgttgcaagtgtcctcttttgatcttttgttgttgcagaggataaag |
357 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19822358 |
attaatttttgtctgatttgtgttaattttggtcgacaatgttgttgcaagtgtcctcttttgatcttttgttgttgcagaggataaag |
19822446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 229 - 274
Target Start/End: Original strand, 19823783 - 19823828
Alignment:
Q |
229 |
tttgtcgtcgtgttcaatttctctccttttctgaacttgtattaat |
274 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
19823783 |
tttgtcgtcgtgttcaatttctctccttttctgaacttctattaat |
19823828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 273 - 352
Target Start/End: Original strand, 30864154 - 30864232
Alignment:
Q |
273 |
atttttgtctgatttgtgttaattttggtcgacaatgttgttgcaagtgtcctcttttgatcttttgttgttgcagagga |
352 |
Q |
|
|
|||||||| |||||| |||||||||| || ||||||||||| ||| ||||||||||||| ||||| |||| ||||||| |
|
|
T |
30864154 |
atttttgt-tgattttggttaattttgatcaacaatgttgttttaagcgtcctcttttgattttttgctgtttcagagga |
30864232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 233
Target Start/End: Complemental strand, 23189935 - 23189902
Alignment:
Q |
200 |
gtttaaggtttagggtttagggtttagggtttgt |
233 |
Q |
|
|
||||| |||||||||||||||||||||||||||| |
|
|
T |
23189935 |
gtttagggtttagggtttagggtttagggtttgt |
23189902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 233
Target Start/End: Complemental strand, 23611190 - 23611157
Alignment:
Q |
200 |
gtttaaggtttagggtttagggtttagggtttgt |
233 |
Q |
|
|
||||| |||||||||||||||||||||||||||| |
|
|
T |
23611190 |
gtttagggtttagggtttagggtttagggtttgt |
23611157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 195 - 231
Target Start/End: Complemental strand, 138 - 102
Alignment:
Q |
195 |
tttaagtttaaggtttagggtttagggtttagggttt |
231 |
Q |
|
|
|||| ||||| |||||||||||||||||||||||||| |
|
|
T |
138 |
tttaggtttagggtttagggtttagggtttagggttt |
102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 175465 times since January 2019
Visitors: 1577