View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_16_18 (Length: 267)

Name: 108_16_18
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_16_18
108_16_18
[»] chr1 (3 HSPs)
chr1 (47-240)||(40961952-40962145)
chr1 (13-52)||(40962216-40962256)
chr1 (47-108)||(40983320-40983381)


Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 47 - 240
Target Start/End: Original strand, 40961952 - 40962145
Alignment:
47 attaattacacaagcctctttattccagcaccaattgaaaaatcaatacccactgtacctgacccatcactcttgttatttattataattacatgttaca 146  Q
    |||||||||||||| |||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40961952 attaattacacaagtctctttcttccagcaccaattgaaaaaccaatacccactgtacctgacccatcactcttgttatttattataattacatgttaca 40962051  T
147 ttggaaataaaattagtataattacaatctaggttagtttgaatattgattaggaaaataatacaaggtagtggtactaccctgagttataatt 240  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
40962052 ttggaaataaaattagtataattacaatctaggttagtttgaatattgattaggaaaataatacaaggtagtggtactaccctgagttttaatt 40962145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 13 - 52
Target Start/End: Original strand, 40962216 - 40962256
Alignment:
13 tacttgaaacaacgggagtatggtg-ttttttgaaattaat 52  Q
    ||||||||||||||||||||||||| |||||||||||||||    
40962216 tacttgaaacaacgggagtatggtgtttttttgaaattaat 40962256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 47 - 108
Target Start/End: Original strand, 40983320 - 40983381
Alignment:
47 attaattacacaagcctctttattccagcaccaattgaaaaatcaatacccactgtacctga 108  Q
    |||||| |||||||||||||| ||||||  ||||||  |||||||||| ||||||| |||||    
40983320 attaatcacacaagcctctttcttccagtgccaattataaaatcaatatccactgtccctga 40983381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106256 times since January 2019
Visitors: 1320