View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_16_55 (Length: 239)

Name: 108_16_55
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_16_55
108_16_55
[»] chr6 (60 HSPs)
chr6 (114-239)||(4613630-4613755)
chr6 (116-234)||(4585733-4585851)
chr6 (1-119)||(4613516-4613634)
chr6 (2-119)||(4557342-4557459)
chr6 (2-114)||(4560723-4560835)
chr6 (2-114)||(4574525-4574637)
chr6 (2-120)||(4622359-4622477)
chr6 (2-119)||(4598388-4598505)
chr6 (4-119)||(4579651-4579766)
chr6 (116-232)||(4592328-4592444)
chr6 (35-119)||(4592481-4592565)
chr6 (121-239)||(4557227-4557345)
chr6 (6-119)||(4461344-4461457)
chr6 (119-228)||(4490278-4490387)
chr6 (119-239)||(4516421-4516541)
chr6 (11-119)||(4563937-4564045)
chr6 (11-119)||(4585862-4585970)
chr6 (114-236)||(4579527-4579649)
chr6 (2-119)||(4571189-4571306)
chr6 (6-111)||(4602010-4602115)
chr6 (6-117)||(4266966-4267077)
chr6 (140-234)||(4457715-4457809)
chr6 (114-232)||(4563806-4563924)
chr6 (122-239)||(4571075-4571192)
chr6 (114-239)||(4598266-4598391)
chr6 (2-119)||(4626168-4626285)
chr6 (19-111)||(4480927-4481019)
chr6 (23-119)||(4490153-4490249)
chr6 (19-111)||(4504203-4504295)
chr6 (6-116)||(4256412-4256523)
chr6 (119-234)||(4480793-4480908)
chr6 (6-116)||(4259955-4260065)
chr6 (123-228)||(3171845-3171950)
chr6 (14-119)||(4470032-4470137)
chr6 (6-111)||(4617243-4617348)
chr6 (120-234)||(4515038-4515152)
chr6 (121-234)||(4469905-4470018)
chr6 (38-119)||(4506110-4506191)
chr6 (120-228)||(4256535-4256643)
chr6 (117-226)||(4299671-4299780)
chr6 (120-197)||(4461224-4461301)
chr6 (119-228)||(4504320-4504429)
chr6 (122-239)||(4574411-4574528)
chr6 (23-119)||(3171979-3172075)
chr6 (122-230)||(4267087-4267195)
chr6 (119-223)||(4568156-4568260)
chr6 (2-116)||(4516538-4516652)
chr6 (35-111)||(4457844-4457920)
chr6 (119-231)||(4601889-4602001)
chr6 (38-117)||(4493208-4493287)
chr6 (6-119)||(4514919-4515032)
chr6 (119-239)||(4560606-4560726)
chr6 (119-239)||(4626051-4626171)
chr6 (120-234)||(4505958-4506072)
chr6 (120-228)||(4260077-4260185)
chr6 (119-231)||(4617122-4617234)
chr6 (65-119)||(4299619-4299673)
chr6 (119-239)||(4622242-4622362)
chr6 (2-110)||(4568273-4568381)
chr6 (48-118)||(4391926-4391996)
[»] chr8 (7 HSPs)
chr8 (121-239)||(16686179-16686297)
chr8 (2-119)||(16686065-16686182)
chr8 (121-227)||(20863767-20863873)
chr8 (5-119)||(20863641-20863755)
chr8 (6-111)||(1674447-1674552)
chr8 (119-231)||(1674326-1674438)
chr8 (79-119)||(1969141-1969181)
[»] chr3 (2 HSPs)
chr3 (6-119)||(1281335-1281448)
chr3 (155-231)||(1281250-1281326)
[»] scaffold0477 (2 HSPs)
scaffold0477 (12-119)||(4484-4591)
scaffold0477 (119-226)||(4611-4718)
[»] chr5 (4 HSPs)
chr5 (6-117)||(24103220-24103331)
chr5 (120-230)||(24103100-24103210)
chr5 (6-108)||(27999908-28000010)
chr5 (119-231)||(28000019-28000131)
[»] scaffold0288 (2 HSPs)
scaffold0288 (119-234)||(3636-3751)
scaffold0288 (6-119)||(3517-3630)
[»] chr7 (2 HSPs)
chr7 (122-239)||(3086523-3086640)
chr7 (33-119)||(3086668-3086754)
[»] scaffold0475 (2 HSPs)
scaffold0475 (31-116)||(3485-3570)
scaffold0475 (173-231)||(3604-3662)


Alignment Details
Target: chr6 (Bit Score: 110; Significance: 1e-55; HSPs: 60)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 114 - 239
Target Start/End: Complemental strand, 4613755 - 4613630
Alignment:
114 caattgccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccat 213  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||    
4613755 caattgccttttgcctcattttctttcctttctctcccaccatcaattcattgaccagcttctctacctcatctctcttcacattggtgtcaatttccat 4613656  T
214 cccaatctcccattcattgcatatat 239  Q
    |||||| |||||||||||||||||||    
4613655 cccaatttcccattcattgcatatat 4613630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 116 - 234
Target Start/End: Original strand, 4585733 - 4585851
Alignment:
116 attgccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcc 215  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||    
4585733 attgccttttgcctcatcttctttccattctctcccaccatcaattcattgaccaacttctccacctcctctctcttcacattggtgtcaacttccatcc 4585832  T
216 caatctcccattcattgca 234  Q
    |||||||||||||||||||    
4585833 caatctcccattcattgca 4585851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 4613634 - 4613516
Alignment:
1 tatatatctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatga 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||    
4613634 tatatatctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggcactccagcacatatgctttcagtggttgagttccatccacaatga 4613535  T
101 gtcaagaatccaccaattg 119  Q
    ||||||||||| |||||||    
4613534 gtcaagaatccgccaattg 4613516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 2 - 119
Target Start/End: Original strand, 4557342 - 4557459
Alignment:
2 atatatctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgag 101  Q
    |||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||    
4557342 atatatctgcagtttgctggctgatcagcaaaaaatggccaacacaacattggaactccagcagatatgctttcagtggttgagttccatccacaatgag 4557441  T
102 tcaagaatccaccaattg 119  Q
    ||||||||||||||||||    
4557442 tcaagaatccaccaattg 4557459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 2 - 114
Target Start/End: Original strand, 4560723 - 4560835
Alignment:
2 atatatctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgag 101  Q
    |||||||| ||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||    
4560723 atatatcttcagtttgctggctgatctgcaaaaaatggccaacacaacattggaactccagcacatatgctttcagtggttgagttccatccgcaatgag 4560822  T
102 tcaagaatccacc 114  Q
    |||||||||||||    
4560823 tcaagaatccacc 4560835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 2 - 114
Target Start/End: Original strand, 4574525 - 4574637
Alignment:
2 atatatctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgag 101  Q
    ||||||||||||||||||||||||||||  |||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||    
4574525 atatatctgcagtttgctggctgatccgaaaaaaatggccaacataacattggaactccagcacatatgctttcagtggttgagttccatccgcaatgag 4574624  T
102 tcaagaatccacc 114  Q
    |||||||||||||    
4574625 tcaagaatccacc 4574637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 2 - 120
Target Start/End: Original strand, 4622359 - 4622477
Alignment:
2 atatatctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgag 101  Q
    |||||||| ||||||| ||||||||| ||||||||||||||||||| ||||| ||||||||||||||| ||||| |||||||| ||||||||||||||||    
4622359 atatatctacagtttgttggctgatcagcgaaaaatggccaacacagcattgaaactccagcacatatgctttcggtggttgaattccatccacaatgag 4622458  T
102 tcaagaatccaccaattgc 120  Q
    |||||||||||||||||||    
4622459 tcaagaatccaccaattgc 4622477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 2 - 119
Target Start/End: Original strand, 4598388 - 4598505
Alignment:
2 atatatctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgag 101  Q
    |||||||||||||| ||| |||||||||||||||| || |||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||||    
4598388 atatatctgcagttggcttgctgatccgcgaaaaagggacaacacaacattggcactccggcacatatactttcagtggttgagttccatccgcaatgag 4598487  T
102 tcaagaatccaccaattg 119  Q
    | ||||||||||||||||    
4598488 ttaagaatccaccaattg 4598505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 4 - 119
Target Start/End: Original strand, 4579651 - 4579766
Alignment:
4 atatctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtc 103  Q
    |||||||||| || |||| ||||| |||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||| |||||||||    
4579651 atatctgcagcttactgggtgatcagcgaaaaatggccaacacaacattggaactccagcagatatgctttcagtgattgagttccatccgcaatgagtc 4579750  T
104 aagaatccaccaattg 119  Q
    ||||||||||||||||    
4579751 aagaatccaccaattg 4579766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 116 - 232
Target Start/End: Original strand, 4592328 - 4592444
Alignment:
116 attgccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcc 215  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||  |  ||||||||||| |||||||| ||||| || |||||||||||||    
4592328 attgcctttttcctcatcttctttcctttctctcccaccatcaattcattgataagtttctccacctcctctctctttacattcgtatcaatttccatcc 4592427  T
216 caatctcccattcattg 232  Q
    |||||||||||||||||    
4592428 caatctcccattcattg 4592444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 35 - 119
Target Start/End: Original strand, 4592481 - 4592565
Alignment:
35 aatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaagaatccaccaattg 119  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4592481 aatggccaacacaacattggaattccagcacatatactttcagtggttgagttccatccacaatgagtcaagaatccaccaattg 4592565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 121 - 239
Target Start/End: Original strand, 4557227 - 4557345
Alignment:
121 cttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaatc 220  Q
    ||||| || |||||||||||||||||| ||| ||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||    
4557227 ctttttccacatcttctttcctttctccccctccatcaattcattgaccaaattctctacctcatctctcttcacattggtgtcaatttccatgccaatc 4557326  T
221 tcccattcattgcatatat 239  Q
    ||||||  |||||| ||||    
4557327 tcccatgtattgcaaatat 4557345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 6 - 119
Target Start/End: Original strand, 4461344 - 4461457
Alignment:
6 atctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaa 105  Q
    |||| |||||||||||||||||  | || ||||||||||||||||| || |||||||||||||| |||||||||||||| ||||||||||||||||||||    
4461344 atctacagtttgctggctgatcaccaaagaatggccaacacaacatcggcactccagcacatatgctttcagtggttgaattccatccacaatgagtcaa 4461443  T
106 gaatccaccaattg 119  Q
    ||||||||||||||    
4461444 gaatccaccaattg 4461457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 119 - 228
Target Start/End: Complemental strand, 4490387 - 4490278
Alignment:
119 gccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaa 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||  ||||| ||||| |||||||| |||||||| ||||||| ||||||||    
4490387 gccttttgcctcatcttctttcctttctctcccaccatcaattcattgatcagtttctctacctcttctctctttacattggtatcaattttcatcccaa 4490288  T
219 tctcccattc 228  Q
    ||||||||||    
4490287 tctcccattc 4490278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 119 - 239
Target Start/End: Original strand, 4516421 - 4516541
Alignment:
119 gccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaa 218  Q
    |||||||||||||||||||||||||| ||||||||||| |||||||||| || |||||||||||| ||||||||||||||||| ||||||||    ||||    
4516421 gccttttgcctcatcttctttcctttatctcccaccattaattcattgatcagcttctccacctcctctctcttcacattggtatcaatttctgctccaa 4516520  T
219 tctcccattcattgcatatat 239  Q
    |||||||||||||||| ||||    
4516521 tctcccattcattgcaaatat 4516541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 11 - 119
Target Start/End: Original strand, 4563937 - 4564045
Alignment:
11 cagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaagaatc 110  Q
    ||||||| |||||||||  | || ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||    
4563937 cagtttgttggctgatcaccaaagaatggccaacacaacattggaactccagcacatatgctttcagtggttgagttccatccgcaatgagtcaagaatc 4564036  T
111 caccaattg 119  Q
    | |||||||    
4564037 cgccaattg 4564045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 11 - 119
Target Start/End: Original strand, 4585862 - 4585970
Alignment:
11 cagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaagaatc 110  Q
    ||||||| ||||||||| || |  |||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |||||||||||||    
4585862 cagtttgttggctgatcagcaatgaatggccaacacaacattggcactccagcacatatgctttcagtggttgagttccatccacagtgagtcaagaatc 4585961  T
111 caccaattg 119  Q
    |||||||||    
4585962 caccaattg 4585970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 114 - 236
Target Start/End: Original strand, 4579527 - 4579649
Alignment:
114 caattgccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccat 213  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |||||||||||| |||||||||||||| ||||| ||||| ||    
4579527 caattgccttttgcctcatcttctttgctttctctcccaccatcaattcattaaccagcttctccacctcctctctcttcacattagtgtcgatttcaat 4579626  T
214 cccaatctcccattcattgcata 236  Q
     ||||| | ||||  ||||||||    
4579627 tccaattttccatgtattgcata 4579649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 2 - 119
Target Start/End: Original strand, 4571189 - 4571306
Alignment:
2 atatatctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgag 101  Q
    |||||||| ||||||||||||||||| || ||||||||| ||||||||||||||||||||| | |||| ||||| || ||||||||||||||||| ||||    
4571189 atatatctacagtttgctggctgatcagcaaaaaatggctaacacaacattggaactccagtagatatgctttcggtcgttgagttccatccacagtgag 4571288  T
102 tcaagaatccaccaattg 119  Q
    ||||||| ||||||||||    
4571289 tcaagaaaccaccaattg 4571306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 6 - 111
Target Start/End: Original strand, 4602010 - 4602115
Alignment:
6 atctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaa 105  Q
    |||| ||||||| ||||||||| || ||||| |||||||||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||||    
4602010 atctacagtttgttggctgatcggcaaaaaaaggccaacacaacatcggcactccagcacatatgctttcagtggttgagttccatccacaatgagtcaa 4602109  T
106 gaatcc 111  Q
    ||||||    
4602110 gaatcc 4602115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 6 - 117
Target Start/End: Complemental strand, 4267077 - 4266966
Alignment:
6 atctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaa 105  Q
    |||| ||||||| |||||||||  | || |||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||| |||||||||||    
4267077 atctacagtttgttggctgatcaccaaagaatggccaacacaacattggcactccagcacatatgctttcagtggttgaattccatccgcaatgagtcaa 4266978  T
106 gaatccaccaat 117  Q
    ||||||||||||    
4266977 gaatccaccaat 4266966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 140 - 234
Target Start/End: Original strand, 4457715 - 4457809
Alignment:
140 cctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaatctcccattcattgca 234  Q
    ||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||| || || ||||||||||||||||| |||||||||||    
4457715 cctttttctcccaccatcaattcattgactaacttctccacctcatctctcttcacatttgtatcgatttccatcccaatctctcattcattgca 4457809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 114 - 232
Target Start/End: Original strand, 4563806 - 4563924
Alignment:
114 caattgccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccat 213  Q
    ||||||||||||||| |||||||||||||||||||||   ||||||||||||||| |  ||||||||||| |||||||| ||||| || || ||||||||    
4563806 caattgccttttgccgcatcttctttcctttctctcctgacatcaattcattgacaagtttctccacctcttctctctttacattcgtatcgatttccat 4563905  T
214 cccaatctcccattcattg 232  Q
    |||||||||||||||||||    
4563906 cccaatctcccattcattg 4563924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 122 - 239
Target Start/End: Original strand, 4571075 - 4571192
Alignment:
122 ttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaatct 221  Q
    |||| |||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |||||||||||| || || ||||| || |||||||    
4571075 tttttcctcatcttctttcctttatctcccaccatcaattcattgaccaaattctccacctcatttctcttcacattagtatcgatttcgattccaatct 4571174  T
222 cccattcattgcatatat 239  Q
    |||||  |||||| ||||    
4571175 cccatgtattgcagatat 4571192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 114 - 239
Target Start/End: Original strand, 4598266 - 4598391
Alignment:
114 caattgccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccat 213  Q
    |||||| |||||||||||| ||||||||||| ||||||  ||||||||| ||||||| |||||||||||| |||||||||||||| || |||||||  ||    
4598266 caattgtcttttgcctcattttctttcctttatctcccgacatcaattcgttgaccagcttctccacctcctctctcttcacattagtttcaattttgat 4598365  T
214 cccaatctcccattcattgcatatat 239  Q
     |||||||||||||||||||| ||||    
4598366 tccaatctcccattcattgcaaatat 4598391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 2 - 119
Target Start/End: Original strand, 4626168 - 4626285
Alignment:
2 atatatctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgag 101  Q
    |||||||| || |||| ||||||||| || |||  ||||||||||| ||||||||||||||| ||||| |||||| ||||||||||||||||||||||||    
4626168 atatatctacaatttgttggctgatcagcaaaatttggccaacacagcattggaactccagcgcatatgctttcaatggttgagttccatccacaatgag 4626267  T
102 tcaagaatccaccaattg 119  Q
    | ||||||||||||||||    
4626268 ttaagaatccaccaattg 4626285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 19 - 111
Target Start/End: Original strand, 4480927 - 4481019
Alignment:
19 tggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaagaatcc 111  Q
    ||||||||| || || |||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||||||||||    
4480927 tggctgatcggcaaagaatggccaacacaacattggcactccagcacatacactttcagtggttgagttccatccgcaatgagtcaagaatcc 4481019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 23 - 119
Target Start/End: Complemental strand, 4490249 - 4490153
Alignment:
23 tgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaagaatccaccaattg 119  Q
    ||||| || ||||||||||||||||||||||| ||||||||||||||||| ||  || |||||||||||||||||||||||||||||||||||||||    
4490249 tgatcagcaaaaaatggccaacacaacattggcactccagcacatatactctccatgattgagttccatccacaatgagtcaagaatccaccaattg 4490153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 19 - 111
Target Start/End: Complemental strand, 4504295 - 4504203
Alignment:
19 tggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaagaatcc 111  Q
    ||||||||| |  ||||||||||||||||||||||| ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||    
4504295 tggctgatcagaaaaaaatggccaacacaacattggcactccagcacaaacactttcagtggttgagttccatccacaatgagtcaagaatcc 4504203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 6 - 116
Target Start/End: Complemental strand, 4256523 - 4256412
Alignment:
6 atctgcagtttgctgg-ctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtca 104  Q
    |||| ||||||| ||| |||||| || ||||||||||||||||||||||||||||| ||||| || |||||| |||||||||||||||| ||||||||||    
4256523 atctacagtttgttggtctgatcagcaaaaaatggccaacacaacattggaactccggcacaaatgctttcaatggttgagttccatcctcaatgagtca 4256424  T
105 agaatccaccaa 116  Q
    ||||||||||||    
4256423 agaatccaccaa 4256412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 119 - 234
Target Start/End: Original strand, 4480793 - 4480908
Alignment:
119 gccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaa 218  Q
    ||||||||| ||||||||||||||||||||||||||| |||||||||||  ||| ||||||| || ||||||||||||||||| || ||||| |  ||||    
4480793 gccttttgcttcatcttctttcctttctctcccaccaacaattcattgattaacctctccacatcttctctcttcacattggtatcgatttcgagtccaa 4480892  T
219 tctcccattcattgca 234  Q
    ||||||||||||||||    
4480893 tctcccattcattgca 4480908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 6 - 116
Target Start/End: Complemental strand, 4260065 - 4259955
Alignment:
6 atctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaa 105  Q
    |||| ||||||| ||||||||| || ||||||||||||||||||||||||||| | ||||| || |||||| |||||||||||||||| |||||||| ||    
4260065 atctacagtttgttggctgatcagcaaaaaatggccaacacaacattggaacttcggcacaaatgctttcaatggttgagttccatccgcaatgagttaa 4259966  T
106 gaatccaccaa 116  Q
    |||||||||||    
4259965 gaatccaccaa 4259955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 123 - 228
Target Start/End: Original strand, 3171845 - 3171950
Alignment:
123 tttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaatctc 222  Q
    |||||||||||||||||||||||||||||||||||||||| |||| ||  ||||| |||||  ||||||| |||||||| |||||||||||||||||||     
3171845 tttgcctcatcttctttcctttctctcccaccatcaattcgttgatcagtttctctacctcccctctctttacattggtatcaatttccatcccaatctt 3171944  T
223 ccattc 228  Q
    ||||||    
3171945 ccattc 3171950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 14 - 119
Target Start/End: Original strand, 4470032 - 4470137
Alignment:
14 tttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaagaatccac 113  Q
    |||||| |||||||  | || |||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||    
4470032 tttgctagctgatcaccaaagaatggccaacacaacattggcactccagcgcatatgctttcagtggttgagttccatccgcaatgagtcaagaatccac 4470131  T
114 caattg 119  Q
    | ||||    
4470132 cgattg 4470137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 6 - 111
Target Start/End: Original strand, 4617243 - 4617348
Alignment:
6 atctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaa 105  Q
    |||| |||| || |||||| || || ||||||||||||||||||||||| |||||||| |||||||||||||||||||| |||||||| |||||||||||    
4617243 atctacagtctgttggctggtcggcaaaaaatggccaacacaacattggcactccagcgcatatactttcagtggttgaattccatccgcaatgagtcaa 4617342  T
106 gaatcc 111  Q
    ||||||    
4617343 gaatcc 4617348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 120 - 234
Target Start/End: Complemental strand, 4515152 - 4515038
Alignment:
120 ccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaat 219  Q
    |||||| |||||| || |||||||||||||||||||||||||||||||| | ||| || ||||| ||||||||||||||  | || ||||| ||||||||    
4515152 cctttttcctcattttatttcctttctctcccaccatcaattcattgacaagcttttcaacctcctctctcttcacattcatatcgatttcgatcccaat 4515053  T
220 ctcccattcattgca 234  Q
    |||||||||||||||    
4515052 ctcccattcattgca 4515038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 121 - 234
Target Start/End: Original strand, 4469905 - 4470018
Alignment:
121 cttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaatc 220  Q
    ||||| ||||||||||||||| |||||||| ||||||||||||||||| | ||||||||||||||||||||||||||   | || ||||| |  ||||||    
4469905 cttttccctcatcttctttccattctctccaaccatcaattcattgactagcttctccacctcatctctcttcacatctttatcgatttcaagtccaatc 4470004  T
221 tcccattcattgca 234  Q
    ||||||||||||||    
4470005 tcccattcattgca 4470018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 38 - 119
Target Start/End: Original strand, 4506110 - 4506191
Alignment:
38 ggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaagaatccaccaattg 119  Q
    |||||||||| |||||| |||||||| ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||    
4506110 ggccaacacagcattggcactccagcgcatatgctttcagtggttgagttccatccgcaatgagtcaagaatccaccaattg 4506191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 120 - 228
Target Start/End: Complemental strand, 4256643 - 4256535
Alignment:
120 ccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaat 219  Q
    ||||||||||||||||||||||||| ||||||  |||||||||||||| ||  |||||||||||||||||||||||||| || |  ||||| || |||||    
4256643 ccttttgcctcatcttctttcctttttctcccgacatcaattcattgatcagattctccacctcatctctcttcacattagtattgatttcaattccaat 4256544  T
220 ctcccattc 228  Q
    |||||||||    
4256543 ctcccattc 4256535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 117 - 226
Target Start/End: Complemental strand, 4299780 - 4299671
Alignment:
117 ttgccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatccc 216  Q
    |||||||||| |||||||| | ||||||||||||||||||||||||||||| || ||| |||||||| |||||| ||||||| || || ||||| || ||    
4299780 ttgccttttgtctcatcttatctcctttctctcccaccatcaattcattgatcagcttttccacctcctctctcctcacatttgtatcgatttcgattcc 4299681  T
217 aatctcccat 226  Q
    ||||||||||    
4299680 aatctcccat 4299671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 120 - 197
Target Start/End: Original strand, 4461224 - 4461301
Alignment:
120 ccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacat 197  Q
    ||||||||||||||||||||||  ||||||| ||||||||||| ||||||||||||||||||||||| ||||||||||    
4461224 ccttttgcctcatcttctttccaatctctccaaccatcaattcgttgaccaacttctccacctcatccctcttcacat 4461301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 119 - 228
Target Start/End: Complemental strand, 4504429 - 4504320
Alignment:
119 gccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaa 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |  |  ||||| ||||| |||||||  |||||||  ||||| | ||||||||    
4504429 gccttttgcctcatcttctttcctttctctcccaccatcaattcattaataagtttctctacctcttctctctgtacattggcatcaatcttcatcccaa 4504330  T
219 tctcccattc 228  Q
    ||||||||||    
4504329 tctcccattc 4504320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 122 - 239
Target Start/End: Original strand, 4574411 - 4574528
Alignment:
122 ttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaatct 221  Q
    ||||||||||||||||||||||| |||||   |||||||||||||||||  ||||||||||| || ||||| ||||| || || |||||| | |||||||    
4574411 ttttgcctcatcttctttcctttatctccggacatcaattcattgaccagtttctccacctcctccctctttacattagtatcgatttcctttccaatct 4574510  T
222 cccattcattgcatatat 239  Q
    ||||||||||||| ||||    
4574511 cccattcattgcaaatat 4574528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 23 - 119
Target Start/End: Original strand, 3171979 - 3172075
Alignment:
23 tgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaagaatccaccaattg 119  Q
    ||||| || |||||||||| |||||||||||| | ||||||||||| |||||| ||||||||||||||||| || |||||||||||||| |||||||    
3171979 tgatcagcaaaaaatggcctacacaacattggcattccagcacatacactttccgtggttgagttccatccgcagtgagtcaagaatccgccaattg 3172075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 122 - 230
Target Start/End: Complemental strand, 4267195 - 4267087
Alignment:
122 ttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaatct 221  Q
    |||||| ||||| | |||||||||||||||||||||||||||||||| |||||||| || ||||||||||||||||| || |  ||||| |  |||||||    
4267195 ttttgcttcatcatatttcctttctctcccaccatcaattcattgactaacttctcgacgtcatctctcttcacatttgtattgatttcgagtccaatct 4267096  T
222 cccattcat 230  Q
    |||||||||    
4267095 cccattcat 4267087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 119 - 223
Target Start/End: Original strand, 4568156 - 4568260
Alignment:
119 gccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaa 218  Q
    ||||||||||||||||| |||||||||| ||||||||| |||||||| | || |||||||||||| |||||||||||||| || |||||||| || || |    
4568156 gccttttgcctcatcttttttcctttctgtcccaccattaattcattcatcagcttctccacctcctctctcttcacatttgtatcaatttcgattccga 4568255  T
219 tctcc 223  Q
    |||||    
4568256 tctcc 4568260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 2 - 116
Target Start/End: Original strand, 4516538 - 4516652
Alignment:
2 atatatctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgag 101  Q
    ||||||||||| |||| |||||| || || ||||| ||||||||||||||||| ||||| ||||| || |||||  | || |||||||||||||||||||    
4516538 atatatctgcaatttgttggctgctcagcaaaaaaaggccaacacaacattggtactccggcacagatgctttccattgtggagttccatccacaatgag 4516637  T
102 tcaagaatccaccaa 116  Q
    |||||||||| ||||    
4516638 tcaagaatcctccaa 4516652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 35 - 111
Target Start/End: Original strand, 4457844 - 4457920
Alignment:
35 aatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaagaatcc 111  Q
    |||||||||| || |||||| |||||||| ||||| ||||||||||||||||| |||||||||||||||||||||||    
4457844 aatggccaacgcagcattggcactccagcgcatatgctttcagtggttgagtttcatccacaatgagtcaagaatcc 4457920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 119 - 231
Target Start/End: Original strand, 4601889 - 4602001
Alignment:
119 gccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaa 218  Q
    |||||||||||||||||||| ||||| |||||  | |||| |||||||| || |||| ||| ||| |||||||||||||| || || |||||||| ||||    
4601889 gccttttgcctcatcttcttgcctttatctccggctatcacttcattgatcagcttcgccaactcctctctcttcacatttgtatcgatttccataccaa 4601988  T
219 tctcccattcatt 231  Q
    |||||||||||||    
4601989 tctcccattcatt 4602001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 38 - 117
Target Start/End: Original strand, 4493208 - 4493287
Alignment:
38 ggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaagaatccaccaat 117  Q
    ||||||||||||||||| ||||| ||||||||  |||  || ||||||||||||||||||||||||||||||||||||||    
4493208 ggccaacacaacattggcactccggcacatatgtttttggtagttgagttccatccacaatgagtcaagaatccaccaat 4493287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 6 - 119
Target Start/End: Complemental strand, 4515032 - 4514919
Alignment:
6 atctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaa 105  Q
    |||| ||||||| ||| |||||  | || ||| ||||||| | |||||| |||||||| ||||| || |||||||||||||||||||| |||||||||||    
4515032 atctacagtttgttggttgatcaccaaagaattgccaacaaagcattggcactccagcgcatatgctctcagtggttgagttccatccgcaatgagtcaa 4514933  T
106 gaatccaccaattg 119  Q
    |||||| |||||||    
4514932 gaatccgccaattg 4514919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 119 - 239
Target Start/End: Original strand, 4560606 - 4560726
Alignment:
119 gccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaa 218  Q
    |||||||||||||||||||||||||| ||||    |||||||||||||||||  |||||||| || || ||||| ||||| || ||||||||  | ||||    
4560606 gccttttgcctcatcttctttcctttatctcaggacatcaattcattgaccagtttctccacgtcctccctctttacatttgtatcaatttcgtttccaa 4560705  T
219 tctcccattcattgcatatat 239  Q
    ||| |||||||||||| ||||    
4560706 tcttccattcattgcaaatat 4560726  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 119 - 239
Target Start/End: Original strand, 4626051 - 4626171
Alignment:
119 gccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaa 218  Q
    ||||||||||||||||||||||| || |||||  |||||||| |||||| ||  ||||| ||| | || ||||||||||| |  || |||||||| ||||    
4626051 gccttttgcctcatcttctttccgttatctcctgccatcaatgcattgatcagtttctctaccccctccctcttcacattagcatcgatttccattccaa 4626150  T
219 tctcccattcattgcatatat 239  Q
    |||||||||||||||| ||||    
4626151 tctcccattcattgcaaatat 4626171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 120 - 234
Target Start/End: Original strand, 4505958 - 4506072
Alignment:
120 ccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaat 219  Q
    |||||| ||||||||| |||||||||||||| ||||| | ||||| ||||| |||||| || |  ||||| |||||||| || |||||||| || |||||    
4505958 cctttttcctcatcttgtttcctttctctccaaccataatttcatcgaccagcttctctacattttctctattcacattagtatcaatttcgattccaat 4506057  T
220 ctcccattcattgca 234  Q
    |||| ||||||||||    
4506058 ctccaattcattgca 4506072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 120 - 228
Target Start/End: Complemental strand, 4260185 - 4260077
Alignment:
120 ccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaat 219  Q
    ||||||||||||||||||||||||  |||||   ||| | |||||||| || |||| ||||||||||||| |||||||| || | |||||| || |||||    
4260185 ccttttgcctcatcttctttccttcttctcctgacataatttcattgatcagcttcgccacctcatctcttttcacattagtattaatttcaattccaat 4260086  T
220 ctcccattc 228  Q
    |||||||||    
4260085 ctcccattc 4260077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 119 - 231
Target Start/End: Original strand, 4617122 - 4617234
Alignment:
119 gccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaa 218  Q
    ||||||||| |||| ||||||||||| |||||  | |||| |||||||| || |||  ||| ||| |||||||||||||| || || |||||||| ||||    
4617122 gccttttgcttcattttctttcctttatctccggctatcacttcattgatcagctttgccaactcctctctcttcacattcgtatcgatttccataccaa 4617221  T
219 tctcccattcatt 231  Q
    |||||||||||||    
4617222 tctcccattcatt 4617234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 65 - 119
Target Start/End: Complemental strand, 4299673 - 4299619
Alignment:
65 catatactttcagtggttgagttccatccacaatgagtcaagaatccaccaattg 119  Q
    ||||| |||||| ||||||||||||||||||| ||||||||||||||||||||||    
4299673 catatgctttcaatggttgagttccatccacagtgagtcaagaatccaccaattg 4299619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 119 - 239
Target Start/End: Original strand, 4622242 - 4622362
Alignment:
119 gccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaa 218  Q
    |||||||| ||||||||||||||||| ||||||  |||||||||||||| ||  |||  |||||| ||||| |||||||| || |  ||||| || ||||    
4622242 gccttttgtctcatcttctttcctttatctcccgacatcaattcattgatcagattcgacacctcctctcttttcacattagtattgatttcgattccaa 4622341  T
219 tctcccattcattgcatatat 239  Q
    ||||||||  |||||| ||||    
4622342 tctcccatgaattgcagatat 4622362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 2 - 110
Target Start/End: Original strand, 4568273 - 4568381
Alignment:
2 atatatctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgag 101  Q
    ||||||||||||| || |||||| || |  ||||| |||||||| |||||||| ||||  ||||| || |||||    || |||||||||||||||||||    
4568273 atatatctgcagtatgttggctgctcagaaaaaaaaggccaacataacattggtactctggcacaaatgctttccaatgtggagttccatccacaatgag 4568372  T
102 tcaagaatc 110  Q
    |||||||||    
4568373 tcaagaatc 4568381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 48 - 118
Target Start/End: Complemental strand, 4391996 - 4391926
Alignment:
48 acattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaagaatccaccaatt 118  Q
    |||||||||||| || ||| || |||||| ||| |||||| ||||||||||| || |||||||||| ||||    
4391996 acattggaactctagaacaaatgctttcaatgggtgagtttcatccacaatgcgttaagaatccacaaatt 4391926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 103; Significance: 2e-51; HSPs: 7)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 121 - 239
Target Start/End: Complemental strand, 16686297 - 16686179
Alignment:
121 cttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaatc 220  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||    
16686297 ctttttcctcatcttctttcctttctctcccaccatcaattcattgaccaatttctccacctcatctctcttcacattggtgtcaatttccatgccaatc 16686198  T
221 tcccattcattgcatatat 239  Q
    |||||||||||||| ||||    
16686197 tcccattcattgcaaatat 16686179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 2 - 119
Target Start/End: Complemental strand, 16686182 - 16686065
Alignment:
2 atatatctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgag 101  Q
    ||||||||||| |||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
16686182 atatatctgcattttgctggctgatcagcaaaaaatggccaacacaacattggaactccagcatatatactttcagtggttgagttccatccacaatgag 16686083  T
102 tcaagaatccaccaattg 119  Q
    | ||||||||||| ||||    
16686082 ttaagaatccaccgattg 16686065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 121 - 227
Target Start/End: Complemental strand, 20863873 - 20863767
Alignment:
121 cttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaatc 220  Q
    ||||||||||||| || |||||||||||||||||||||||||||| |||| | |||||||||| |||||||| ||||||||||||||||| |||||||||    
20863873 cttttgcctcatcctccttcctttctctcccaccatcaattcatttaccagcatctccacctcctctctcttgacattggtgtcaatttcgatcccaatc 20863774  T
221 tcccatt 227  Q
    |||||||    
20863773 tcccatt 20863767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 5 - 119
Target Start/End: Complemental strand, 20863755 - 20863641
Alignment:
5 tatctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtca 104  Q
    |||||||||||||  |||||||| || ||||||||||| ||||||||||| |||||||||||||| || ||| ||||||||||||||||||||||||| |    
20863755 tatctgcagtttgtcggctgatcagcaaaaaatggccagcacaacattggcactccagcacatatgctctcaatggttgagttccatccacaatgagtta 20863656  T
105 agaatccaccaattg 119  Q
      |||||||||||||    
20863655 gaaatccaccaattg 20863641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 6 - 111
Target Start/End: Original strand, 1674447 - 1674552
Alignment:
6 atctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaa 105  Q
    |||| ||||||| ||||||||| || ||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||||| || || |||||    
1674447 atctacagtttgttggctgatcagcaaaaaatggccaacacaacattggcactccagcgcatatgctttcagtggttgagttccatccgcagtgtgtcaa 1674546  T
106 gaatcc 111  Q
    ||||||    
1674547 gaatcc 1674552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 119 - 231
Target Start/End: Original strand, 1674326 - 1674438
Alignment:
119 gccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaa 218  Q
    ||||||||||||||||| ||||| |||||||||||||||||||||||||  | ||||||||   | |||||||||||||| || ||||||||||| ||||    
1674326 gccttttgcctcatcttttttccattctctcccaccatcaattcattgataagcttctccaaaccctctctcttcacattcgtatcaatttccataccaa 1674425  T
219 tctcccattcatt 231  Q
    ||| |||||||||    
1674426 tcttccattcatt 1674438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 79 - 119
Target Start/End: Complemental strand, 1969181 - 1969141
Alignment:
79 ggttgagttccatccacaatgagtcaagaatccaccaattg 119  Q
    |||||| ||||| ||||||||||||||||||||||||||||    
1969181 ggttgaattccagccacaatgagtcaagaatccaccaattg 1969141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 6 - 119
Target Start/End: Original strand, 1281335 - 1281448
Alignment:
6 atctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaa 105  Q
    |||| |||| || ||||||||| || ||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||    
1281335 atctacagtctgttggctgatcagcaaaaaatggccaacacaacattggcactccagcacatatgctttcagtggttgagttccatccgcaatgagtcaa 1281434  T
106 gaatccaccaattg 119  Q
    ||||||||| ||||    
1281435 gaatccaccgattg 1281448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 155 - 231
Target Start/End: Original strand, 1281250 - 1281326
Alignment:
155 atcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaatctcccattcatt 231  Q
    ||||||||||||| ||||||  ||||||| |||||||||||||| || || |||||||| ||||||| |||||||||    
1281250 atcaattcattgatcaacttagccacctcctctctcttcacatttgtatcgatttccataccaatcttccattcatt 1281326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0477 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: scaffold0477
Description:

Target: scaffold0477; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 12 - 119
Target Start/End: Complemental strand, 4591 - 4484
Alignment:
12 agtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaagaatcc 111  Q
    |||||| ||||||||| |||||||||||||||||||||||||| |||||  ||||||| |||||| |||||||||||||||| |||||||||||||||||    
4591 agtttgttggctgatcggcgaaaaatggccaacacaacattggcactcctacacatatgctttcaatggttgagttccatccgcaatgagtcaagaatcc 4492  T
112 accaattg 119  Q
    ||||||||    
4491 accaattg 4484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0477; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 119 - 226
Target Start/End: Complemental strand, 4718 - 4611
Alignment:
119 gccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaa 218  Q
    |||||||||||||||||| ||||||| ||||||  |||||||||||||| ||  |||   ||||  |||||||||||||| || ||||||||||| |||     
4718 gccttttgcctcatcttcattcctttatctcccgacatcaattcattgatcatattcgttaccttctctctcttcacattagtatcaatttccataccag 4619  T
219 tctcccat 226  Q
    ||||||||    
4618 tctcccat 4611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 6 - 117
Target Start/End: Original strand, 24103220 - 24103331
Alignment:
6 atctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaa 105  Q
    |||| ||||||| ||| |||||  | || |||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| |||||||||||    
24103220 atctacagtttgttggttgatcaccaaagaatggccaacacaacattggcactccagcacatatgctttcagtggttgagttccatccgcaatgagtcaa 24103319  T
106 gaatccaccaat 117  Q
    ||||||||||||    
24103320 gaatccaccaat 24103331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 120 - 230
Target Start/End: Original strand, 24103100 - 24103210
Alignment:
120 ccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaat 219  Q
    |||||||| ||||| ||||||| |||||||||||||||||||||||||| |||||||| || ||||||||||||||||| || || ||||| |  |||||    
24103100 ccttttgcttcatcgtctttccgttctctcccaccatcaattcattgactaacttctcgacgtcatctctcttcacatttgtatcgatttcgagtccaat 24103199  T
220 ctcccattcat 230  Q
    |||||||||||    
24103200 ctcccattcat 24103210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 6 - 108
Target Start/End: Complemental strand, 28000010 - 27999908
Alignment:
6 atctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaa 105  Q
    |||| ||||||| ||||||||| || ||||||| ||||||||||||||| |||||||| ||||| ||||| ||||||||||||||||| || ||||||||    
28000010 atctacagtttgttggctgatcagcaaaaaatgaccaacacaacattggcactccagcgcatatgctttcggtggttgagttccatccgcagtgagtcaa 27999911  T
106 gaa 108  Q
    |||    
27999910 gaa 27999908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 119 - 231
Target Start/End: Complemental strand, 28000131 - 28000019
Alignment:
119 gccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaa 218  Q
    ||||||||||||||||| ||||| |||||||||||||||||||||||||  | ||||||||  || ||| ||||||||||  | ||||||||||| ||||    
28000131 gccttttgcctcatcttttttccattctctcccaccatcaattcattgataagcttctccaaatcctctatcttcacattcatatcaatttccataccaa 28000032  T
219 tctcccattcatt 231  Q
    ||| |||||||||    
28000031 tcttccattcatt 28000019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0288 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: scaffold0288
Description:

Target: scaffold0288; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 119 - 234
Target Start/End: Complemental strand, 3751 - 3636
Alignment:
119 gccttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaa 218  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||||||||||||||||||   | || ||||| |  ||||    
3751 gccttttgcctcatcttctttcctttctctcccaccgtcaattcattgactagcttctccacctcatctctcttcacatccatatcgatttcaagtccaa 3652  T
219 tctcccattcattgca 234  Q
    |||||||||| |||||    
3651 tctcccattcgttgca 3636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0288; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 6 - 119
Target Start/End: Complemental strand, 3630 - 3517
Alignment:
6 atctgcagtttgctggctgatccgcgaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaa 105  Q
    |||| ||||||| |||||||||  | || ||||||||||| | |||||| |||||||| ||||| |||||||||||||| ||||||||||||||||||||    
3630 atctacagtttgttggctgatcaccaaagaatggccaacaaagcattggtactccagcgcatatgctttcagtggttgaattccatccacaatgagtcaa 3531  T
106 gaatccaccaattg 119  Q
    ||||||||||||||    
3530 gaatccaccaattg 3517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 122 - 239
Target Start/End: Original strand, 3086523 - 3086640
Alignment:
122 ttttgcctcatcttctttcctttctctcccaccatcaattcattgaccaacttctccacctcatctctcttcacattggtgtcaatttccatcccaatct 221  Q
    ||||||||||||||||||||||| |||||||||||||||||||||| || |||||| ||||| |||||||||||||| || || ||||| || |||||||    
3086523 ttttgcctcatcttctttcctttatctcccaccatcaattcattgatcagcttctcgacctcctctctcttcacattagtatcgatttcaattccaatct 3086622  T
222 cccattcattgcatatat 239  Q
    |||||  |||||| ||||    
3086623 cccatatattgcagatat 3086640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 33 - 119
Target Start/End: Original strand, 3086668 - 3086754
Alignment:
33 aaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaagaatccaccaattg 119  Q
    |||||||||||||||||||||| |||||||||  ||  ||||||   ||||||||||||||||||||||||||||||||||||||||    
3086668 aaaatggccaacacaacattggcactccagcaagtacgctttcaaccgttgagttccatccacaatgagtcaagaatccaccaattg 3086754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0475 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: scaffold0475
Description:

Target: scaffold0475; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 31 - 116
Target Start/End: Complemental strand, 3570 - 3485
Alignment:
31 gaaaaatggccaacacaacattggaactccagcacatatactttcagtggttgagttccatccacaatgagtcaagaatccaccaa 116  Q
    |||||||||||||| || |||||||||||||| ||| || |||||| ||||||||||||||||||||||||| |||||||||||||    
3570 gaaaaatggccaacgcagcattggaactccagaacaaatgctttcaatggttgagttccatccacaatgagttaagaatccaccaa 3485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0475; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 231
Target Start/End: Complemental strand, 3662 - 3604
Alignment:
173 ttctccacctcatctctcttcacattggtgtcaatttccatcccaatctcccattcatt 231  Q
    ||||||||||| ||||||||||||||||  || |||||  | |||||||||||||||||    
3662 ttctccacctcctctctcttcacattggaatctatttcacttccaatctcccattcatt 3604  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108000 times since January 2019
Visitors: 1329