View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_17_16 (Length: 622)

Name: 108_17_16
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_17_16
108_17_16
[»] chr7 (4 HSPs)
chr7 (1-363)||(3224826-3225188)
chr7 (402-590)||(3225249-3225438)
chr7 (43-336)||(3184571-3184864)
chr7 (404-507)||(3184133-3184236)


Alignment Details
Target: chr7 (Bit Score: 335; Significance: 0; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 335; E-Value: 0
Query Start/End: Original strand, 1 - 363
Target Start/End: Complemental strand, 3225188 - 3224826
Alignment:
1 ataacaatttaaaaccttgataacaagacaaatatgttaatgtatattacctttgtcacacttttcagggtgcatattccatgttgttaatgcaataaca 100  Q
    |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3225188 ataacaatttaaaatcttgataacaagactaatatgttaatgtatattacctttgtcacacttttcagggtgcatattccatgttgttaatgcaataaca 3225089  T
101 caagccagtgtgctaaggatccgatcatgtgttaaaaacagttgactaccaccccatgaaccatcttgaagttgatttttcacaatccactctaaacttg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| |    
3225088 caagccagtgtgctaaggatccgatcatgtgttaaaaacagttgactatcaccccatgaaccatcttgaagttgatttttcacaatccactctagactag 3224989  T
201 atggaaattgtggtgtaccactagaatgtacatcttccacaagtgcaacccaagcagtatcataagcagacatatttgtctttccatcttccaatgaact 300  Q
    |||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3224988 atggaaattgtggtgtaccactagtatgcacatcttccacaagtgcaacccaagcagtatcataagcagacatatttgtctttccatcttccaatgaact 3224889  T
301 caatattgatttgattgagttcactaaaccgaccttcttattaaccataaaatgtatattaat 363  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3224888 caatattgatttgattgagttcactaaaccgaccttcttattaaccataaaatgtatattaat 3224826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 164; E-Value: 2e-87
Query Start/End: Original strand, 402 - 590
Target Start/End: Complemental strand, 3225438 - 3225249
Alignment:
402 agtaccttctaagtttttcatctctctttgcaaaaatgtttttcaatattggagaatcatttggcacatcaatgttcaatctacgagctctatcaagaag 501  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3225438 agtaccttctaagtttttcatctctctttgcaaaaatgttttttaatattggagaatcatttggcacatcaatgttcaatctacgagctctatcaagaag 3225339  T
502 tgnagggaaaataacntcaaaaccaactagctcc-cattctcatcctcaagcttgtcaagattctctctgaaaaatgacattgctatata 590  Q
    || |||||| ||||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3225338 tgaagggaatataacttcaaaaccagctagctcctcattctcatcctcaagcttgtcaagattctctctgaaaaatgacattgctatata 3225249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 138; E-Value: 8e-72
Query Start/End: Original strand, 43 - 336
Target Start/End: Original strand, 3184571 - 3184864
Alignment:
43 tatattacctttgtcacacttttcagggtgcatattccatgttgttaatgcaataacacaagccagtgtgctaaggatccgatcatgtgttaaaaacagt 142  Q
    |||||||||||| || |||||||| |||||||||||||| | | |||| |||||||||||||||| |||| ||| ||| |||||||| |   |||||| |    
3184571 tatattacctttctcgcacttttcggggtgcatattccacgatcttaaagcaataacacaagccaatgtgttaatgattcgatcatgagcagaaaacaat 3184670  T
143 tgactaccaccccatgaaccatcttgaagttgatttttcacaatccactctaaacttgatggaaattgtggtgtaccactagaatgtacatcttccacaa 242  Q
    |||||| |||||||||||||||||||||||||||||||   |||||| |||| |||||| |||||||| || |||||||||  ||| |||||||| ||||    
3184671 tgactatcaccccatgaaccatcttgaagttgatttttagaaatccattctagacttgagggaaattgaggagtaccactattatgaacatcttcaacaa 3184770  T
243 gtgcaacccaagcagtatcataagcagacatatttgtctttccatcttccaatgaactcaatattgatttgattgagttcactaaaccgacctt 336  Q
    | |||||||||||||||||||||||||| ||| || ||| ||||||||||| |||| |||||||||||||||||  |||||||||||| |||||    
3184771 gagcaacccaagcagtatcataagcagatatagttatctctccatcttccattgaattcaatattgatttgattttgttcactaaaccaacctt 3184864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 85; E-Value: 3e-40
Query Start/End: Original strand, 404 - 507
Target Start/End: Original strand, 3184133 - 3184236
Alignment:
404 taccttctaagtttttcatctctctttgcaaaaatgtttttcaatattggagaatcatttggcacatcaatgttcaatctacgagctctatcaagaagtg 503  Q
    |||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||    
3184133 taccttttgagtttttcatctctctttgcaaaaatgtttttcaatattggagaatcatttggcacatcaatgttcaatcttcgagctctatcgagaagtg 3184232  T
504 nagg 507  Q
     |||    
3184233 aagg 3184236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176063 times since January 2019
Visitors: 1578