View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_18_24 (Length: 255)

Name: 108_18_24
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_18_24
108_18_24
[»] chr8 (2 HSPs)
chr8 (59-255)||(32401103-32401299)
chr8 (1-64)||(32401044-32401107)


Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 59 - 255
Target Start/End: Complemental strand, 32401299 - 32401103
Alignment:
59 attaataataattttcccttctcctnnnnnnnnttataacctcatcacggtaagcttcaacaggatgcttcccaagatcttggtaaagagctttagatat 158  Q
    |||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32401299 attaataataattttcccttctcctaaaaaaaattataacctcatcacggtaagcttcaacaggatgcttcccaagatcttggtaaagagctttagatat 32401200  T
159 agcatcttcattttcatgaattaggttaagtagagctttgagctgattttttctccatgtaacacttcttgtttttcctgttttgaagtattgtctc 255  Q
    ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
32401199 agcatcttcattttcatgaattaggttaagtagagctttgagctggttttttctccatgtaacacttcttgtttttcctgttttgaagtattgtctc 32401103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 32401107 - 32401044
Alignment:
1 gtctcaaatctcttacagtttcttctacttccacaccaatgttgttgttcattgtaggattaat 64  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32401107 gtctcaaatctcttacagtttcttctacttccacaccaatgttgttgttcattgtaggattaat 32401044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361240 times since January 2019
Visitors: 487