View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_18_25 (Length: 244)

Name: 108_18_25
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_18_25
108_18_25
[»] chr3 (4 HSPs)
chr3 (1-114)||(35986290-35986403)
chr3 (131-177)||(35986135-35986181)
chr3 (195-236)||(35986253-35986294)
chr3 (78-117)||(10297251-10297291)


Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 35986290 - 35986403
Alignment:
1 cacttcactagaagaaaatagaagtgtctagtatctattttatgtttctttttcgtagtaaaaattattannnnnnnaaataatttagtttgtt-agata 99  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||       ||||||||||||||||| |||||    
35986290 cacttcactagaagaaaatagaagtgtctagtatatattttatgtttctttttcgtagtaaaaattatta-ttttttaaataatttagtttgttcagata 35986388  T
100 caactatatataaaa 114  Q
    |||||||||| ||||    
35986389 caactatataaaaaa 35986403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 131 - 177
Target Start/End: Original strand, 35986135 - 35986181
Alignment:
131 aaattaattcttcatattttgcgggattcaaataaacggaatcaaat 177  Q
    ||||||||||||||||||||| |||||||||||||||||||||||||    
35986135 aaattaattcttcatattttgtgggattcaaataaacggaatcaaat 35986181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 195 - 236
Target Start/End: Original strand, 35986253 - 35986294
Alignment:
195 aagaaaaaaccacttttttagcaatctaaattcgacacactt 236  Q
    |||||||||||||||||||||||||| |||||||||||||||    
35986253 aagaaaaaaccacttttttagcaatccaaattcgacacactt 35986294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 78 - 117
Target Start/End: Complemental strand, 10297291 - 10297251
Alignment:
78 aaataatttagtttgttag-atacaactatatataaaaggg 117  Q
    ||||||||||||||||| | |||||||||||||||||||||    
10297291 aaataatttagtttgtttggatacaactatatataaaaggg 10297251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361224 times since January 2019
Visitors: 487