View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_18_26 (Length: 392)

Name: 108_18_26
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_18_26
108_18_26
[»] chr1 (2 HSPs)
chr1 (124-352)||(9699312-9699538)
chr1 (1-114)||(9699828-9699941)


Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 124 - 352
Target Start/End: Original strand, 9699312 - 9699538
Alignment:
124 attaatcgccagagtaaatccccttcgggctgtgttgataaaattgggtcttcattgaaacggggagcctcgtagtatgctttaaaaattcctgaaaata 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
9699312 attaatcgccagagtaaatccccttcgggctgtgttgataaaattgggtcttcattgaaacggggagcctggtagtatgctttaaaaattcctgaaaata 9699411  T
224 ccattgaaaccaatccggcaaagatgattcccacgccttgcattgcgaaaactgctgctatgaaagcgcctcgtgtccttttgttggcatattcnnacat 323  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||  ||||    
9699412 ccattgaaaccaatccggcaaagatgattcccacgccttgcattgcgaaaactgctgctatgaaagcgcctcgtgtccttttgttggcgtattcagacat 9699511  T
324 ggatggttgcctgataaagggtagtctcc 352  Q
     |||||||| |||||||||||||||||||    
9699512 -gatggttg-ctgataaagggtagtctcc 9699538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 9699828 - 9699941
Alignment:
1 caagcaaccatgataatgagtgtgacaccntaaactttcttgcgtccaagtttgtctccgagccagccgaagactaattggccagaaagtgttccgacaa 100  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9699828 caagcaaccatgataatgagtgtgacaccataaactttcttgcgtccaagtttgtctccgagccagccgaagactaattggccagaaagtgttccgacaa 9699927  T
101 gggccacaccggtg 114  Q
    ||||||||||||||    
9699928 gggccacaccggtg 9699941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 203125 times since January 2019
Visitors: 1517