View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_18_35 (Length: 353)

Name: 108_18_35
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_18_35
108_18_35
[»] chr2 (3 HSPs)
chr2 (93-329)||(4782410-4782645)
chr2 (1-98)||(4783196-4783293)
chr2 (225-329)||(4787287-4787391)


Alignment Details
Target: chr2 (Bit Score: 181; Significance: 1e-97; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 93 - 329
Target Start/End: Original strand, 4782410 - 4782645
Alignment:
93 attaatctatttatgataatctatgtattttttagtcgatgatgagaaatgtacttaatacaataatttatctttttaccaatttaaaattaagacaaca 192  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4782410 attaatctatttatgataatctatgtattttttagtcgatgataagaaatgtacttaatacaataatttatctttttaccaatttaaaattaagacaaca 4782509  T
193 tcacttacttggttcttatttttcatccatttgcagggaatatntgatggacccnattgtccgataaattctaaagatacnaatcattgtgtgttaatag 292  Q
    |||||||||||||||||| |||||||||||||||||||||||| |||||||||| |||||||| | |||||||||||||| ||||||||||| |||||||    
4782510 tcacttacttggttctta-ttttcatccatttgcagggaatatatgatggacccaattgtccggtgaattctaaagatacaaatcattgtgttttaatag 4782608  T
293 ngggttatgattcaatagacggccaagattcttggat 329  Q
     ||||||||||||| | || || ||||||| ||||||    
4782609 tgggttatgattcagtggatggtcaagattattggat 4782645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 4783196 - 4783293
Alignment:
1 accaagtctatcaaaaaggtccatattttaaaactgagaagaaagctaggtgttgtagcttttgaaagtttaaattaagaaagcatgttgagattaat 98  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4783196 accaagtctatcaaaaaggtccatattttaaaactgagaagaaagctaggtgttgtagcttttgaaagtttaaattaagaaagcatgttgagattaat 4783293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 225 - 329
Target Start/End: Original strand, 4787287 - 4787391
Alignment:
225 gcagggaatatntgatggacccnattgtccgataaattctaaagatacnaatcattgtgtgttaatagngggttatgattcaatagacggccaagattct 324  Q
    ||||||||||| |||||||||| |||||||| | |||||||||||||| ||||||||||| ||||||| ||||||||||||| | || || ||||||| |    
4787287 gcagggaatatatgatggacccaattgtccggtgaattctaaagatacaaatcattgtgtattaatagtgggttatgattcagtggatggtcaagattat 4787386  T
325 tggat 329  Q
    |||||    
4787387 tggat 4787391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360747 times since January 2019
Visitors: 486