View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_18_36 (Length: 603)

Name: 108_18_36
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_18_36
108_18_36
[»] chr1 (1 HSPs)
chr1 (50-603)||(47798081-47798646)
[»] chr4 (2 HSPs)
chr4 (50-522)||(39777497-39777976)
chr4 (521-592)||(39778011-39778082)
[»] chr5 (3 HSPs)
chr5 (73-199)||(5677762-5677888)
chr5 (434-522)||(5677435-5677523)
chr5 (264-337)||(5677612-5677685)


Alignment Details
Target: chr1 (Bit Score: 499; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 499; E-Value: 0
Query Start/End: Original strand, 50 - 603
Target Start/End: Complemental strand, 47798646 - 47798081
Alignment:
50 attaattgaactcattgacgtctctggtggatcagaaacatttgaactagcagcaaagttctgttactggataaactttgaaataagcgttgaaagcatc 149  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47798646 attaattgaactcattgacgtctctggtggatcagaaacatttgaactagcagcaaagttctgttactggataaactttgaaataagcgttgaaagcatc 47798547  T
150 gctatgcttcgatgtgtggccaaatatcttgaaatgacagaagattattcgg------------taggaataaccgattcttacttgaatgaagttgcac 237  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||            |||||| |||||||||||||||||||||||||||||    
47798546 actatgcttcgatgtgtggccaaatatcttgaaatgacagaagattattcggacagaaatatggtaggaagaaccgattcttacttgaatgaagttgcac 47798447  T
238 tcaagagcatgtcaggggcaatatccatcttacatacatcagaaactcttcttccaattgcaaagaaagcaaaattagttagcagatgcataaatgcaat 337  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47798446 tcaagagcatgtcaggggcaatatccatcttacatacatcagaaactcttcttccaattgcaaagaaagcaaaattagttagcagatgcataaatgcaat 47798347  T
338 agcctgcctacatagctttccaaggagagccactttggttcatctggtagaagtgatggtagtagcaatgaaagagagatgagttcttccaatgcttctc 437  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47798346 agcctgcctacatagctttccaaggagagtcactttggttcatctggtagaagtgatggtagtagcaatgaaagagagatgagttcttccaatgcttctc 47798247  T
438 accagaggccagctattgattggtgggctgaagatctaactgttcttagaattgactttttccaaagagttctaattgcaatgattataatgctttattc 537  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
47798246 accagaggccagctattgattggtgggctgaagatctaactgttcttagaattgtctttttccaaagagttctaattgcaatgattataatgctttattc 47798147  T
538 acaaaaatctctgagaggnttggtaagtctctttactaaagaaggaaagttttcacncatcagttt 603  Q
    |||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |||||||||    
47798146 acaaaaatctctgagaggtttggtaagtccctttactaaagaaggaaagttttcacacatcagttt 47798081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 311; Significance: 1e-175; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 50 - 522
Target Start/End: Original strand, 39777497 - 39777976
Alignment:
50 attaattgaactcattgacgtctctggtggatcagaaacatttgaactagcagcaaagttctgttactggataaactttgaaataagcgttgaaagcatc 149  Q
    ||||||||||||||| || ||| |||||||||||||| ||||||||||||||||||||||||||||| |||||||||| ||||||||||| |||| ||||    
39777497 attaattgaactcatcgatgtccctggtggatcagaagcatttgaactagcagcaaagttctgttacgggataaacttcgaaataagcgtcgaaaacatc 39777596  T
150 gctatgcttcgatgtgtggccaaatatcttgaaatgacagaagattattcggt------------aggaataaccgattcttacttgaatgaagttgcac 237  Q
    ||||||||||||||||| ||| | |||||||||||||||||||||||||||||            ||||| ||| |||||||||||||||||||||||||    
39777597 gctatgcttcgatgtgtagccgagtatcttgaaatgacagaagattattcggtcggaaatttggtaggaagaactgattcttacttgaatgaagttgcac 39777696  T
238 tcaagagcatgtcaggggcaatatccatcttacatacatcagaaactcttcttccaattgcaaagaaagcaaaattagttagcagatgcataaatgcaat 337  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |||||||    
39777697 tcaagagcatgtcaggggcaatatccatcttacatacatcagaaacacttcttccaattgcagagaaagcaaaattagttagcagatgcatagatgcaat 39777796  T
338 agcctgcctacatagctttccaaggagagccactttggttcatctggtagaagtgatggtagtagcaatgaaagagagatgagttcttccaatgcttctc 437  Q
    ||||| |    ||||||| |||||||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||  ||||||||    
39777797 agccttc----atagctt-ccaaggagagtcagtttggttcatctggtagaagtgatggtagtagcaatgaaagagtgatgaattcttccgctgcttctc 39777891  T
438 accagaggccagctattgattggtgggctgaagatctaactgttcttagaattgactttttccaaagagttctaattgcaatgat 522  Q
    |||| ||||||||| ||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||    
39777892 accaaaggccagctgttgattggtgggctgaagatctaacagttcttaaaattgactttttccaaagagttctaattgcaatgat 39777976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 521 - 592
Target Start/End: Original strand, 39778011 - 39778082
Alignment:
521 attataatgctttattcacaaaaatctctgagaggnttggtaagtctctttactaaagaaggaaagttttca 592  Q
    |||||||||||||||||||| |||||||||||||| |||||||||| |||||||||||||||||| ||||||    
39778011 attataatgctttattcacagaaatctctgagaggtttggtaagtccctttactaaagaaggaaaattttca 39778082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 67; Significance: 2e-29; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 73 - 199
Target Start/End: Complemental strand, 5677888 - 5677762
Alignment:
73 ctggtggatcagaaacatttgaactagcagcaaagttctgttactggataaactttgaaataagcgttgaaagcatcgctatgcttcgatgtgtggccaa 172  Q
    |||||||| ||||| ||||||||||||||||||| ||||| ||| | ||||| || || ||||  || |||| ||||||||||||||||||||||||| |    
5677888 ctggtggagcagaagcatttgaactagcagcaaaattctgctacggtataaatttcgagataaatgtggaaaacatcgctatgcttcgatgtgtggccga 5677789  T
173 atatcttgaaatgacagaagattattc 199  Q
    ||||||||| |||||||||||||||||    
5677788 atatcttgagatgacagaagattattc 5677762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 434 - 522
Target Start/End: Complemental strand, 5677523 - 5677435
Alignment:
434 tctcaccagaggccagctattgattggtgggctgaagatctaactgttcttagaattgactttttccaaagagttctaattgcaatgat 522  Q
    ||||| ||||| |||| | ||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||| ||||||||    
5677523 tctcaacagagaccagttgttgattggtgggctgaagatctaactgttcttagaattgacctttttcaaagagttctaatagcaatgat 5677435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 264 - 337
Target Start/End: Complemental strand, 5677685 - 5677612
Alignment:
264 atcttacatacatcagaaactcttcttccaattgcaaagaaagcaaaattagttagcagatgcataaatgcaat 337  Q
    ||||||||||  |||||||  ||||||||||| ||| ||||| ||||||| || |||| ||||||| |||||||    
5677685 atcttacatatttcagaaagccttcttccaatagcagagaaaacaaaattggtgagcaaatgcatagatgcaat 5677612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 308749 times since January 2019
Visitors: 442