View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_18_50 (Length: 236)

Name: 108_18_50
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_18_50
108_18_50
[»] chr7 (6 HSPs)
chr7 (2-236)||(35448932-35449166)
chr7 (60-236)||(35449163-35449339)
chr7 (1-196)||(35448744-35448936)
chr7 (61-223)||(35440925-35441087)
chr7 (82-230)||(35440702-35440850)
chr7 (68-113)||(35454520-35454565)


Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-128; HSPs: 6)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 2 - 236
Target Start/End: Complemental strand, 35449166 - 35448932
Alignment:
2 tggagacctgcccaattgtcggcaatacatcagctacgccaatctttaataacggtactggatcaccatttcgtatggttgatatgtctgctcatggaga 101  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35449166 tggaggcctgcccaattgtcggcaatacatcagctacgccaatctttaataacggtactggatcaccatttcgtatggttgatatgtctgctcatggaga 35449067  T
102 tttttcaagcatgcattatagtcagaactcgaacatgggttttcaacaaggaattaatggggggatggccataacagaacctgaatatccaagttcttct 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35449066 tttttcaagcatgcattatagtcagaactcgaacatgggttttcaacaaggaattaatggggggatggccataacagaacctgaatatccaagttcttct 35448967  T
202 cctagcatgtttggtgttgatgaaaatgtcatgga 236  Q
    |||||||||||||||||||||||||||||||||||    
35448966 cctagcatgtttggtgttgatgaaaatgtcatgga 35448932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 60 - 236
Target Start/End: Complemental strand, 35449339 - 35449163
Alignment:
60 tggatcaccatttcgtatggttgatatgtctgctcatggagatttttcaagcatgcattatagtcagaactcgaacatgggttttcaacaaggaattaat 159  Q
    ||||||| | ||| ||||||||||  |||||||||| ||||||| ||||| ||||||||||||||||||| |||||||||| ||||||||||||||||||    
35449339 tggatcatcgtttggtatggttgacgtgtctgctcaaggagattgttcaaccatgcattatagtcagaacacgaacatgggctttcaacaaggaattaat 35449240  T
160 ggggggatggccataacagaacctgaatatccaagttcttctcctagcatgtttggtgttgatgaaaatgtcatgga 236  Q
    | ||| || |||||| |||||||||||||||||||||||||| || ||||||||||| |||||||||||||| ||||    
35449239 gagggaatagccatatcagaacctgaatatccaagttcttctactcgcatgtttggtattgatgaaaatgtcctgga 35449163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 35448936 - 35448744
Alignment:
1 atggagacctgcccaattgtcggcaatacatcagctacgccaatctttaataacggtactggatcaccatttcgtatggttgatatgtctgctcatggag 100  Q
    ||||||||||||||||||||| | ||| ||||||||| |||||||| || ||| |||   |||||| |||||| ||||||||| ||||||||||| ||||    
35448936 atggagacctgcccaattgtcaggaatgcatcagctatgccaatctatagtaatggt---ggatcatcatttcatatggttgagatgtctgctcacggag 35448840  T
101 atttttcaagcatgcattatagtcagaactcgaacatgggttttcaacaaggaattaatggggggatggccataacagaacctgaatatccaagtt 196  Q
    || ||| |||||||||| ||||||||||||| ||||||| ||| || |||||| ||||||||  ||||||||||  | ||||||||||| ||||||    
35448839 atattttaagcatgcatcatagtcagaactcaaacatggatttgcagcaaggagttaatgggcagatggccatagtacaacctgaatattcaagtt 35448744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 61 - 223
Target Start/End: Complemental strand, 35441087 - 35440925
Alignment:
61 ggatcaccatttcgtatggttgatatgtctgctcatggagatttttcaagcatgcattatagtcagaactcgaacatgggttttcaacaaggaattaatg 160  Q
    |||||| ||||| |||||||||||| |||||||||||||||| || ||||||||  || || ||||||||| ||||||||| | ||||||||| ||||||    
35441087 ggatcatcatttggtatggttgatacgtctgctcatggagatattccaagcatgacttttactcagaactcaaacatgggtatgcaacaaggagttaatg 35440988  T
161 gggggatggccataacagaacctgaatatccaagttcttctcctagcatgtttggtgttgatg 223  Q
    |||| ||| ||||| |  |||||||  || |||||| |||||||  ||||||||||| |||||    
35440987 ggggaatgaccatatccaaacctgataattcaagtttttctcctcacatgtttggtgctgatg 35440925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 82 - 230
Target Start/End: Complemental strand, 35440850 - 35440702
Alignment:
82 gatatgtctgctcatggagatttttcaagcatgcattatagtcagaactcgaacatgggttttcaacaaggaattaatggggggatggccataacagaac 181  Q
    ||||||| || ||| |||||| || ||||||||  ||||| ||| ||| | ||||||||| | ||||||||||| ||||| ||||||  || | || |||    
35440850 gatatgtttgttcaaggagatattccaagcatggcttatactcataacacaaacatgggtgtgcaacaaggaatcaatggtgggatgaacacatcaaaac 35440751  T
182 ctgaatatccaagttcttctcctagcatgtttggtgttgatgaaaatgt 230  Q
    ||| |||| |||||| |||||||  ||||||||||| | ||| ||||||    
35440750 ctggatattcaagttattctcctcacatgtttggtgctcatggaaatgt 35440702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 68 - 113
Target Start/End: Complemental strand, 35454565 - 35454520
Alignment:
68 catttcgtatggttgatatgtctgctcatggagatttttcaagcat 113  Q
    ||||| |||||||||||| |||||||||||||||| ||||||||||    
35454565 catttggtatggttgataagtctgctcatggagatatttcaagcat 35454520  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111135 times since January 2019
Visitors: 1335