View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_18_57 (Length: 391)

Name: 108_18_57
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_18_57
108_18_57
[»] chr6 (2 HSPs)
chr6 (1-166)||(18621113-18621278)
chr6 (227-389)||(18620953-18621115)
[»] chr1 (2 HSPs)
chr1 (229-389)||(45061752-45061912)
chr1 (1-162)||(45061593-45061754)
[»] chr7 (3 HSPs)
chr7 (158-230)||(3162492-3162564)
chr7 (171-230)||(18991740-18991799)
chr7 (171-230)||(18959833-18959892)
[»] chr3 (1 HSPs)
chr3 (158-230)||(13225709-13225781)
[»] scaffold0625 (1 HSPs)
scaffold0625 (171-230)||(4961-5020)
[»] chr4 (1 HSPs)
chr4 (158-230)||(1540624-1540695)
[»] chr5 (2 HSPs)
chr5 (53-153)||(42166012-42166112)
chr5 (53-153)||(42176653-42176753)
[»] chr2 (1 HSPs)
chr2 (172-227)||(34389584-34389640)


Alignment Details
Target: chr6 (Bit Score: 166; Significance: 9e-89; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 166; E-Value: 9e-89
Query Start/End: Original strand, 1 - 166
Target Start/End: Original strand, 18621113 - 18621278
Alignment:
1 ggtttctcatgagtgggaactcatcaacaagcagaagccaatctggctgcgcaagccagaagagatcaccaaggatgaatatgctgctttctacaagagc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18621113 ggtttctcatgagtgggaactcatcaacaagcagaagccaatctggctgcgcaagccagaagagatcaccaaggatgaatatgctgctttctacaagagc 18621212  T
101 ctaaccaatgactgggaagaacacttggctgtgaagcatttctctgtggagggccagcttgaattc 166  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18621213 ctaaccaatgactgggaagaacacttggctgtgaagcatttctctgtggagggccagcttgaattc 18621278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 227 - 389
Target Start/End: Original strand, 18620953 - 18621115
Alignment:
227 aattcattagttacccaatctacctttggactgaaaagactactgagaaagagatcagtgatgatgaagatgacgagcccaagaaggaagaagaaggtgt 326  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
18620953 aattcattagctacccaatctacctttggactgaaaagactactgagaaagagatcagtgatgatgaagatgatgagcccaagaaggaagaagaaggtgt 18621052  T
327 ggtcgaggaagttgatgaggacaaggagaangatgccaagaagaaaaagaagattaaggaggt 389  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||    
18621053 ggtcgaggaagttgatgaggacaaggagaaagatgccaagaagaaaaagaagattaaggaggt 18621115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 78; Significance: 3e-36; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 229 - 389
Target Start/End: Complemental strand, 45061912 - 45061752
Alignment:
229 ttcattagttacccaatctacctttggactgaaaagactactgagaaagagatcagtgatgatgaagatgacgagcccaagaaggaagaagaaggtgtgg 328  Q
    |||||||| |||||||||||||| |||||||| ||||| |||||||||||||| ||||||||||| ||||| || |||||||||||||| ||||| |  |    
45061912 ttcattagctacccaatctacctctggactgagaagacaactgagaaagagattagtgatgatgaggatgatgaacccaagaaggaagaggaaggagatg 45061813  T
329 tcgaggaagttgatgaggacaaggagaangatgccaagaagaaaaagaagattaaggaggt 389  Q
    | ||||| || ||||| |  |||||||| ||| | ||||||||||||||||||||||||||    
45061812 ttgaggatgtagatgaagggaaggagaaagattcaaagaagaaaaagaagattaaggaggt 45061752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 45061754 - 45061593
Alignment:
1 ggtttctcatgagtgggaactcatcaacaagcagaagccaatctggctgcgcaagccagaagagatcaccaaggatgaatatgctgctttctacaagagc 100  Q
    |||||||||||||||| |||  |||||||| ||||| ||||| ||| |||| |||||||||||||| || |||||||| |||||| | ||||||||||||    
45061754 ggtttctcatgagtggcaacaaatcaacaaacagaaaccaatttggttgcgtaagccagaagagattacaaaggatgagtatgcttcattctacaagagc 45061655  T
101 ctaaccaatgactgggaagaacacttggctgtgaagcatttctctgtggagggccagcttga 162  Q
     | || ||||| |||||||||||||||||||| ||||| || ||||||||||| || |||||    
45061654 attactaatgattgggaagaacacttggctgttaagcacttttctgtggagggtcaacttga 45061593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 73; Significance: 3e-33; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 158 - 230
Target Start/End: Complemental strand, 3162564 - 3162492
Alignment:
158 cttgaattcgggccttcttttcacactcttacgcatatgaaaataatggacaaaatgggatttggattcaatt 230  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3162564 cttgaattcgggccttcttttcacactcttacgcatatgaaaataatggacaaaatgggatttggattcaatt 3162492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 171 - 230
Target Start/End: Original strand, 18991740 - 18991799
Alignment:
171 cttcttttcacactcttacgcatatgaaaataatggacaaaatgggatttggattcaatt 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18991740 cttcttttcacactcttacgcatatgaaaataatggacaaaatgggatttggattcaatt 18991799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 171 - 230
Target Start/End: Original strand, 18959833 - 18959892
Alignment:
171 cttcttttcacactcttacgcatatgaaaataatggacaaaatgggatttggattcaatt 230  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
18959833 cttcttttcacaatcttacgcatatgaaaataatggacaaaatgggatttggattcaatt 18959892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 158 - 230
Target Start/End: Original strand, 13225709 - 13225781
Alignment:
158 cttgaattcgggccttcttttcacactcttacgcatatgaaaataatggacaaaatgggatttggattcaatt 230  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13225709 cttgaattcgggccttcttttcacactcttacgcatatgaaaataatggacaaaatgggatttggattcaatt 13225781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0625 (Bit Score: 60; Significance: 2e-25; HSPs: 1)
Name: scaffold0625
Description:

Target: scaffold0625; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 171 - 230
Target Start/End: Complemental strand, 5020 - 4961
Alignment:
171 cttcttttcacactcttacgcatatgaaaataatggacaaaatgggatttggattcaatt 230  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5020 cttcttttcacactcttacgcatatgaaaataatggacaaaatgggatttggattcaatt 4961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 158 - 230
Target Start/End: Original strand, 1540624 - 1540695
Alignment:
158 cttgaattcgggccttcttttcacactcttacgcatatgaaaataatggacaaaatgggatttggattcaatt 230  Q
    ||||| ||| |||||||||||||||||||||||||||||||||||||  || |||| ||||||||||||||||    
1540624 cttgatttcaggccttcttttcacactcttacgcatatgaaaataattaac-aaattggatttggattcaatt 1540695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 53 - 153
Target Start/End: Complemental strand, 42166112 - 42166012
Alignment:
53 aagccagaagagatcaccaaggatgaatatgctgctttctacaagagcctaaccaatgactgggaagaacacttggctgtgaagcatttctctgtggagg 152  Q
    ||||| || ||||| || |||||||| ||||||||||| |||||||| || |||||||| |||||||| || |||||||| ||||| ||||| || ||||    
42166112 aagcccgaggagattacaaaggatgagtatgctgctttttacaagagtctcaccaatgattgggaagagcatttggctgttaagcacttctcagttgagg 42166013  T
153 g 153  Q
    |    
42166012 g 42166012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 53 - 153
Target Start/End: Complemental strand, 42176753 - 42176653
Alignment:
53 aagccagaagagatcaccaaggatgaatatgctgctttctacaagagcctaaccaatgactgggaagaacacttggctgtgaagcatttctctgtggagg 152  Q
    ||||| || ||||| || |||||||| ||||||||||| |||||||| || |||||||| |||||||| || |||||||| ||||| ||||| || ||||    
42176753 aagcccgaggagattacaaaggatgagtatgctgctttttacaagagtctcaccaatgattgggaagagcatttggctgttaagcacttctcagttgagg 42176654  T
153 g 153  Q
    |    
42176653 g 42176653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 172 - 227
Target Start/End: Complemental strand, 34389640 - 34389584
Alignment:
172 ttcttttcacactctt-acgcatatgaaaataatggacaaaatgggatttggattca 227  Q
    ||||| |||||||||| | |||||||||||||||||||||||| |||| | ||||||    
34389640 ttcttgtcacactctttatgcatatgaaaataatggacaaaattggatattgattca 34389584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106232 times since January 2019
Visitors: 1320