View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_18_6 (Length: 287)

Name: 108_18_6
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_18_6
108_18_6
[»] chr3 (2 HSPs)
chr3 (1-158)||(49308528-49308686)
chr3 (151-287)||(49308396-49308532)
[»] chr5 (3 HSPs)
chr5 (1-158)||(41609909-41610067)
chr5 (151-287)||(41609777-41609913)
chr5 (8-76)||(18862304-18862371)
[»] chr8 (1 HSPs)
chr8 (8-76)||(25230032-25230099)


Alignment Details
Target: chr3 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 49308528 - 49308686
Alignment:
1 cagaagataacgaaagggaaacctagaaaatcaaaggg-atgttactaaggactttagcaattgtggaagaaaaagacacaaacatgcaattttttacta 99  Q
    |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| |||||||||||||||||||||| |||||||||||||||||||    
49308528 cagaagataacgaaagggaaacctagaaaatcaaaggggatgtttctaaggactttaacaattgtggaagaaaaagacacgaacatgcaattttttacta 49308627  T
100 tgataatagtacccacgagataaagaaggatgtcaagtgaaagaaaattaaaaattaat 158  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49308628 tgataatagtacccacgagataaagaaggatgtcaagtgaaagaaaattaaaaattaat 49308686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 151 - 287
Target Start/End: Original strand, 49308396 - 49308532
Alignment:
151 aaattaatgttggcataaattcatgggatttttgtttgagaaagttctgttgtttgaatttcatagtttttataaaattgcacttgataattatttgctt 250  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49308396 aaattaatgttggcataaattcatgggatttttgtatgagaaagttctgttgtttgaatttcatagtttttataaaattgcacttgataattatttgctt 49308495  T
251 ggatatgataattttaggttgttagatatgcacagaa 287  Q
    |||||||||||||||||||||||||||||||||||||    
49308496 ggatatgataattttaggttgttagatatgcacagaa 49308532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 158
Target Start/End: Original strand, 41609909 - 41610067
Alignment:
1 cagaagataacgaaagggaaacctagaaaatcaaaggg-atgttactaaggactttagcaattgtggaagaaaaagacacaaacatgcaattttttacta 99  Q
    |||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||||||||||||||||||| ||||||    
41609909 cagaagataacgaaagggaaacctagaaaatcaaaggggatgtttctaaggactttaacaattgtggaagaaaaagacacaaacatgcaatttcttacta 41610008  T
100 tgataatagtacccacgagataaagaaggatgtcaagtgaaagaaaattaaaaattaat 158  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
41610009 tgataatagtacccacgagataaagaaggatgtcaagtgaaagaaaattaaaatttaat 41610067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 151 - 287
Target Start/End: Original strand, 41609777 - 41609913
Alignment:
151 aaattaatgttggcataaattcatgggatttttgtttgagaaagttctgttgtttgaatttcatagtttttataaaattgcacttgataattatttgctt 250  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
41609777 aaattaatgttggcataaattcatgggatttttgtttgagaaagttctgttgtttgaatttcataatttttataaaattgcacttgataattatttgctt 41609876  T
251 ggatatgataattttaggttgttagatatgcacagaa 287  Q
    |||||||||||||||||||||||||||||||||||||    
41609877 ggatatgataattttaggttgttagatatgcacagaa 41609913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 76
Target Start/End: Complemental strand, 18862371 - 18862304
Alignment:
8 taacgaaagggaaacctagaaaatcaaagggatgttactaaggactttagcaattgtggaagaaaaaga 76  Q
    |||||||| |||||||||||||||||||||| | || ||||||| || | |||||||| ||||||||||    
18862371 taacgaaatggaaacctagaaaatcaaaggggtttttctaagga-ttgaacaattgtgaaagaaaaaga 18862304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 76
Target Start/End: Complemental strand, 25230099 - 25230032
Alignment:
8 taacgaaagggaaacctagaaaatcaaagggatgttactaaggactttagcaattgtggaagaaaaaga 76  Q
    |||||||| |||||||||||||||||||||| | || ||||||| || | |||| ||| ||||||||||    
25230099 taacgaaatggaaacctagaaaatcaaaggggtttttctaagga-ttgaacaatcgtgaaagaaaaaga 25230032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106252 times since January 2019
Visitors: 1320