View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_18_75 (Length: 280)

Name: 108_18_75
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_18_75
108_18_75
[»] chr7 (10 HSPs)
chr7 (1-84)||(33416363-33416446)
chr7 (177-277)||(33410302-33410401)
chr7 (177-277)||(33416151-33416250)
chr7 (177-277)||(33424204-33424303)
chr7 (1-84)||(33428090-33428173)
chr7 (177-265)||(33428298-33428385)
chr7 (114-176)||(33416476-33416538)
chr7 (1-73)||(33410514-33410586)
chr7 (1-73)||(33424416-33424488)
chr7 (134-174)||(33410664-33410704)
[»] chr1 (2 HSPs)
chr1 (1-69)||(24985049-24985117)
chr1 (1-69)||(24990879-24990947)


Alignment Details
Target: chr7 (Bit Score: 84; Significance: 6e-40; HSPs: 10)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 33416363 - 33416446
Alignment:
1 agtgcttcgttttttggtggaaaagtgcagctctggaagagtgtgccattcactttaaaaacattgtgccttgaagggtcatag 84  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33416363 agtgcttcgttttttggtggaaaagtgcagctctggaagagtgtgccattcactttaaaaacattgtgccttgaagggtcatag 33416446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 177 - 277
Target Start/End: Original strand, 33410302 - 33410401
Alignment:
177 caattgcaaccatgattgccatgacnactccaaacacagatgaaacaacaggagtgagcatcagaanaaggtggtggagaangagcaggtgctncttcgg 276  Q
    ||||||||||||||||||||||||| |||||||||| ||||||||||||| ||||||||||||||| |||||||||||||| ||||||||||  ||||||    
33410302 caattgcaaccatgattgccatgacaactccaaacagagatgaaacaaca-gagtgagcatcagaagaaggtggtggagaaggagcaggtgcaccttcgg 33410400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 177 - 277
Target Start/End: Original strand, 33416151 - 33416250
Alignment:
177 caattgcaaccatgattgccatgacnactccaaacacagatgaaacaacaggagtgagcatcagaanaaggtggtggagaangagcaggtgctncttcgg 276  Q
    ||||||||||||||||||||||||| |||||||||| ||||||||||||| ||||||||||||||| |||||||||||||| ||||||||||  ||||||    
33416151 caattgcaaccatgattgccatgacaactccaaacagagatgaaacaaca-gagtgagcatcagaagaaggtggtggagaaggagcaggtgcaccttcgg 33416249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 177 - 277
Target Start/End: Original strand, 33424204 - 33424303
Alignment:
177 caattgcaaccatgattgccatgacnactccaaacacagatgaaacaacaggagtgagcatcagaanaaggtggtggagaangagcaggtgctncttcgg 276  Q
    ||||||||||||||||||||||||| |||||||||| ||||||||||||| ||||||||||||||| |||||||||||||| ||||||||||  ||||||    
33424204 caattgcaaccatgattgccatgacaactccaaacagagatgaaacaaca-gagtgagcatcagaagaaggtggtggagaaggagcaggtgcaccttcgg 33424302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 84
Target Start/End: Complemental strand, 33428173 - 33428090
Alignment:
1 agtgcttcgttttttggtggaaaagtgcagctctggaagagtgtgccattcactttaaaaacattgtgccttgaagggtcatag 84  Q
    ||||||||||||| ||||||||||||||| ||||| |||| |||||| |||||||| ||||||||||| |||||||||||||||    
33428173 agtgcttcgttttgtggtggaaaagtgcatctctgaaagaatgtgccgttcactttgaaaacattgtgtcttgaagggtcatag 33428090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 177 - 265
Target Start/End: Complemental strand, 33428385 - 33428298
Alignment:
177 caattgcaaccatgattgccatgacnactccaaacacagatgaaacaacaggagtgagcatcagaanaaggtggtggagaangagcagg 265  Q
    |||||||||||||| |||||||||| |||||||||||||||||||||||| || |||||||||||| |||||||  ||||| |||||||    
33428385 caattgcaaccatggttgccatgacaactccaaacacagatgaaacaaca-gaatgagcatcagaagaaggtggaagagaaggagcagg 33428298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 114 - 176
Target Start/End: Original strand, 33416476 - 33416538
Alignment:
114 ttagatcatgtntgananatacaaaagttaattataactatgagatacactaattagttaagc 176  Q
    ||||||||||| ||| | |||||||||||||||||||||||||||||||||||||||||||||    
33416476 ttagatcatgtttgataaatacaaaagttaattataactatgagatacactaattagttaagc 33416538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 33410514 - 33410586
Alignment:
1 agtgcttcgttttttggtggaaaagtgcagctctggaagagtgtgccattcactttaaaaacattgtgccttg 73  Q
    |||||||| ||||||||||||||||||||||| || |||||||||||||| ||||| ||||||||||||||||    
33410514 agtgcttcattttttggtggaaaagtgcagctttgaaagagtgtgccatttactttgaaaacattgtgccttg 33410586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 33424416 - 33424488
Alignment:
1 agtgcttcgttttttggtggaaaagtgcagctctggaagagtgtgccattcactttaaaaacattgtgccttg 73  Q
    |||||||| ||||||||||||||||||||||| || |||||||||||||| ||||| ||||||||||||||||    
33424416 agtgcttcattttttggtggaaaagtgcagctttgaaagagtgtgccatttactttgaaaacattgtgccttg 33424488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 134 - 174
Target Start/End: Original strand, 33410664 - 33410704
Alignment:
134 acaaaagttaattataactatgagatacactaattagttaa 174  Q
    ||||||||||||||||| |||||||||||||||||||||||    
33410664 acaaaagttaattataattatgagatacactaattagttaa 33410704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 24985117 - 24985049
Alignment:
1 agtgcttcgttttttggtggaaaagtgcagctctggaagagtgtgccattcactttaaaaacattgtgc 69  Q
    |||||||| |||| || ||||||||||||||| || |||||| | |||| |||||| || |||||||||    
24985117 agtgcttcattttctgatggaaaagtgcagctttgaaagagtttaccatccactttgaagacattgtgc 24985049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 24990947 - 24990879
Alignment:
1 agtgcttcgttttttggtggaaaagtgcagctctggaagagtgtgccattcactttaaaaacattgtgc 69  Q
    |||||||| |||| || ||||||||||||||| || |||||| | |||| |||||| || |||||||||    
24990947 agtgcttcattttctgatggaaaagtgcagctttgaaagagtttaccatccactttgaagacattgtgc 24990879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 202745 times since January 2019
Visitors: 1517