View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_18_83 (Length: 403)

Name: 108_18_83
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_18_83
108_18_83
[»] chr7 (5 HSPs)
chr7 (218-393)||(43702814-43702992)
chr7 (132-225)||(3266906-3266999)
chr7 (69-110)||(43701787-43701828)
chr7 (97-139)||(43701745-43701787)
chr7 (218-269)||(18947986-18948038)


Alignment Details
Target: chr7 (Bit Score: 133; Significance: 5e-69; HSPs: 5)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 218 - 393
Target Start/End: Complemental strand, 43702992 - 43702814
Alignment:
218 tcaattgggaacctgaaagagatttggcaatgagaacacaaaccagaaacaatgaaggggtggcgtttgtttttgatgagatgaa---ggagtgcatgat 314  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||   ||||| ||||||    
43702992 tcaattgggaacctgaaagagatttggcaatgagaacacaaaccagaaacaatggaggggtggcgtttgtttttgatgagatgaaggaggagtacatgat 43702893  T
315 gtgtctcattggaggaggaagagcagagggtgtgtgttnatttttcggtaaaatnntgctttttctaaacttnttactc 393  Q
    |||||| ||||||||||||||||||||||||||||||| |||||||||||||||  || ||||||||||| | ||||||    
43702892 gtgtcttattggaggaggaagagcagagggtgtgtgtttatttttcggtaaaataatgttttttctaaacattttactc 43702814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 132 - 225
Target Start/End: Complemental strand, 3266999 - 3266906
Alignment:
132 acaattgttcactatatcatgactctttttaatttattaatctttgctttatcaatagttacatgaaaagttcatatacacgcatatcaattgg 225  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
3266999 acaattgttcactatatcatgactctttttaatttattaatctttgctttatcaatagttacatgaaaagttaatatacacgcatatcaattgg 3266906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 69 - 110
Target Start/End: Complemental strand, 43701828 - 43701787
Alignment:
69 cctcacacacaaaatcacaacagcggcatccatactcttatt 110  Q
    ||||||||||||||||||||||||||||||||||| ||||||    
43701828 cctcacacacaaaatcacaacagcggcatccatacacttatt 43701787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 97 - 139
Target Start/End: Complemental strand, 43701787 - 43701745
Alignment:
97 tccatactcttattatttcagattactactactccacaattgt 139  Q
    |||||||||||||||||||||||||||||| ||| ||||||||    
43701787 tccatactcttattatttcagattactactcctcgacaattgt 43701745  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 218 - 269
Target Start/End: Original strand, 18947986 - 18948038
Alignment:
218 tcaattgggaacctgaaagagatttggcaatg-agaacacaaaccagaaacaa 269  Q
    ||||||| ||||||||||||||||||| |||| | ||||||||||||||||||    
18947986 tcaattgtgaacctgaaagagatttggtaatgaaaaacacaaaccagaaacaa 18948038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 307533 times since January 2019
Visitors: 441