View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_18_96 (Length: 489)

Name: 108_18_96
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_18_96
108_18_96
[»] chr7 (10 HSPs)
chr7 (133-489)||(43702623-43702991)
chr7 (241-390)||(18947286-18947443)
chr7 (433-489)||(12642583-12642639)
chr7 (433-489)||(42709230-42709286)
chr7 (258-395)||(18948181-18948327)
chr7 (69-110)||(43701787-43701828)
chr7 (391-427)||(29723181-29723217)
chr7 (133-183)||(18947987-18948038)
chr7 (450-489)||(43259293-43259332)
chr7 (97-138)||(43701746-43701787)
[»] chr1 (2 HSPs)
chr1 (433-489)||(43669655-43669711)
chr1 (433-489)||(46900155-46900211)
[»] chr2 (3 HSPs)
chr2 (261-391)||(6204506-6204645)
chr2 (391-427)||(36963356-36963392)
chr2 (283-335)||(39062852-39062904)
[»] chr8 (3 HSPs)
chr8 (433-489)||(41741078-41741134)
chr8 (331-390)||(43235431-43235490)
chr8 (300-335)||(42578773-42578808)
[»] chr5 (2 HSPs)
chr5 (433-489)||(39949073-39949129)
chr5 (332-393)||(29984836-29984897)
[»] chr3 (5 HSPs)
chr3 (433-489)||(33516702-33516758)
chr3 (262-388)||(46461865-46461999)
chr3 (391-427)||(46878716-46878752)
chr3 (391-427)||(49319571-49319607)
chr3 (354-390)||(39232331-39232367)
[»] chr4 (2 HSPs)
chr4 (440-489)||(25107601-25107650)
chr4 (432-485)||(22118720-22118774)
[»] chr6 (1 HSPs)
chr6 (450-489)||(20797086-20797125)


Alignment Details
Target: chr7 (Bit Score: 279; Significance: 1e-156; HSPs: 10)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 133 - 489
Target Start/End: Complemental strand, 43702991 - 43702623
Alignment:
133 caattgggaacctgaaagagatttggcaatgagaacacaaaccagaaacaatgaaggggtggcgtttgtttttgatgagatgaaggag---tgcatgatg 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||   | |||||||    
43702991 caattgggaacctgaaagagatttggcaatgagaacacaaaccagaaacaatggaggggtggcgtttgtttttgatgagatgaaggaggagtacatgatg 43702892  T
230 tgtctcattggaggaggaagagcagagggtgtgtgtttatttttcggtaaaataatgctttttctaaacattttactctcagccattgattttatttttg 329  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||| ||||||||||||    
43702891 tgtcttattggaggaggaagagcagagggtgtgtgtttatttttcggtaaaataatgttttttctaaacattttactctcagtcatttattttatttttg 43702792  T
330 cc---------acatctatgaagtgaattggtataaatggaggctctttaaatggagcaaagatgcactcgttttaaacagtgcatgggtagttgaagta 420  Q
    ||         |||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||| ||||||||    
43702791 ccacatatgaaacatctatgaagtgaatttgtataaatggaggctccttaaatggagcaaagatgcactcgttttaaatagtgcatgggtaattgaagta 43702692  T
421 attcttaggaaatggatcatctgcagcattttctctcctgcactccctgctgcccttttatgttcctat 489  Q
    ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43702691 attattaggaaatggatcatctgcagcattttctctcctgcactccctgctgcccttttatgttcctat 43702623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 241 - 390
Target Start/End: Complemental strand, 18947443 - 18947286
Alignment:
241 aggaggaagagcagagggtgtgtgtttatttttcggtaaaataatgctttttctaaacattttactctcagccattgattttatttttgccacat----- 335  Q
    |||||||||||||||||  ||||||||||||| |||||||  |||||||||||||| | || || ||||| |||||| |||||| ||||||||||         
18947443 aggaggaagagcagaggc-gtgtgtttattttccggtaaataaatgctttttctaagccttctaatctcaaccattggttttatatttgccacatgtcca 18947345  T
336 ----ctatgaagtgaattggtataaatggaggctctttaaatggagcaaagatgcactc 390  Q
        |||||||||||| ||||||||||||||||||  ||||||||||||||||||||||    
18947344 acatctatgaagtgaaatggtataaatggaggctccctaaatggagcaaagatgcactc 18947286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 433 - 489
Target Start/End: Complemental strand, 12642639 - 12642583
Alignment:
433 tggatcatctgcagcattttctctcctgcactccctgctgcccttttatgttcctat 489  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
12642639 tggatcatctgcagcactttctctcctgcactccctgctgcccttttatgttcctat 12642583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 433 - 489
Target Start/End: Original strand, 42709230 - 42709286
Alignment:
433 tggatcatctgcagcattttctctcctgcactccctgctgcccttttatgttcctat 489  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
42709230 tggatcatctgcagcactttctctcctgcactccctgctgcccttttatgttcctat 42709286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 258 - 395
Target Start/End: Original strand, 18948181 - 18948327
Alignment:
258 gtgtgtgtttatttttcggtaaaataatgctttttctaaacattttactctcagccattgattttatttttgccacatct---------atgaagtgaat 348  Q
    |||||| ||| |||||| |||||  |||| ||||||||| | ||||| ||||||||||| ||||||| |||||||||| |         ||||||||||     
18948181 gtgtgtttttgtttttcagtaaagaaatgttttttctaagccttttaatctcagccattaattttatatttgccacatgtcaaacatccatgaagtgaaa 18948280  T
349 tggtataaatggaggctctttaaatggagcaaagatgcactcgtttt 395  Q
    ||||||||||| ||||||  |||||||||||||||||||||| ||||    
18948281 tggtataaatgaaggctccctaaatggagcaaagatgcactcttttt 18948327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 69 - 110
Target Start/End: Complemental strand, 43701828 - 43701787
Alignment:
69 cctcacacacaaaatcacaacagcggcatccatactcttatt 110  Q
    ||||||||||||||||||||||||||||||||||| ||||||    
43701828 cctcacacacaaaatcacaacagcggcatccatacacttatt 43701787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 391 - 427
Target Start/End: Complemental strand, 29723217 - 29723181
Alignment:
391 gttttaaacagtgcatgggtagttgaagtaattctta 427  Q
    |||||||| ||||||||||||||||||||||||||||    
29723217 gttttaaatagtgcatgggtagttgaagtaattctta 29723181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 133 - 183
Target Start/End: Original strand, 18947987 - 18948038
Alignment:
133 caattgggaacctgaaagagatttggcaatg-agaacacaaaccagaaacaa 183  Q
    |||||| ||||||||||||||||||| |||| | ||||||||||||||||||    
18947987 caattgtgaacctgaaagagatttggtaatgaaaaacacaaaccagaaacaa 18948038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 450 - 489
Target Start/End: Complemental strand, 43259332 - 43259293
Alignment:
450 tttctctcctgcactccctgctgcccttttatgttcctat 489  Q
    |||||||||||||||| ||||| |||||||||||||||||    
43259332 tttctctcctgcactctctgcttcccttttatgttcctat 43259293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 97 - 138
Target Start/End: Complemental strand, 43701787 - 43701746
Alignment:
97 tccatactcttattatttcagattaccactactccacaattg 138  Q
    |||||||||||||||||||||||||| ||| ||| |||||||    
43701787 tccatactcttattatttcagattactactcctcgacaattg 43701746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 53; Significance: 3e-21; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 433 - 489
Target Start/End: Original strand, 43669655 - 43669711
Alignment:
433 tggatcatctgcagcattttctctcctgcactccctgctgcccttttatgttcctat 489  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
43669655 tggatcatctgcagcactttctctcctgcactccctgctgcccttttatgttcctat 43669711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 433 - 489
Target Start/End: Original strand, 46900155 - 46900211
Alignment:
433 tggatcatctgcagcattttctctcctgcactccctgctgcccttttatgttcctat 489  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||    
46900155 tggatcatctgcagcactttctctcctgcactccctgctgcccttttatgtttctat 46900211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 52; Significance: 1e-20; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 261 - 391
Target Start/End: Complemental strand, 6204645 - 6204506
Alignment:
261 tgtgtttatttttcggtaaaataatgctttttctaaacattttactctcagccattgattttatttttgccacat---------ctatgaagtgaattgg 351  Q
    |||||||||||| | |||||  |||| |||||  |||| ||||| |||| |||||||||||||| ||||||||||         || |||||||||||||    
6204645 tgtgtttattttccagtaaacaaatgattttttaaaaccttttaatctctgccattgattttatatttgccacatgttaaacatctgtgaagtgaattgg 6204546  T
352 tataaatggaggctctttaaatggagcaaagatgcactcg 391  Q
    ||||||||||||||| ||||||||||||||||||| ||||    
6204545 tataaatggaggctccttaaatggagcaaagatgctctcg 6204506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 391 - 427
Target Start/End: Complemental strand, 36963392 - 36963356
Alignment:
391 gttttaaacagtgcatgggtagttgaagtaattctta 427  Q
    |||||||| ||||||||||||||||||||||||||||    
36963392 gttttaaatagtgcatgggtagttgaagtaattctta 36963356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 283 - 335
Target Start/End: Original strand, 39062852 - 39062904
Alignment:
283 aatgctttttctaaacattttactctcagccattgattttatttttgccacat 335  Q
    ||||||||||| |||| ||||| ||  |||||||||||||||| |||||||||    
39062852 aatgctttttccaaaccttttaatcctagccattgattttattgttgccacat 39062904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 49; Significance: 8e-19; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 433 - 489
Target Start/End: Complemental strand, 41741134 - 41741078
Alignment:
433 tggatcatctgcagcattttctctcctgcactccctgctgcccttttatgttcctat 489  Q
    |||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||    
41741134 tggatcatctgcagcactttctctcctgcactccctgctgcctttttatgttcctat 41741078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 331 - 390
Target Start/End: Complemental strand, 43235490 - 43235431
Alignment:
331 cacatctatgaagtgaattggtataaatggaggctctttaaatggagcaaagatgcactc 390  Q
    |||||||||||||||||  || |||||||||||||   ||||||||||||||||||||||    
43235490 cacatctatgaagtgaaaagggataaatggaggcttggtaaatggagcaaagatgcactc 43235431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 300 - 335
Target Start/End: Complemental strand, 42578808 - 42578773
Alignment:
300 ttttactctcagccattgattttatttttgccacat 335  Q
    ||||| ||||||||||||||||||||||||||||||    
42578808 ttttaatctcagccattgattttatttttgccacat 42578773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 49; Significance: 8e-19; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 433 - 489
Target Start/End: Complemental strand, 39949129 - 39949073
Alignment:
433 tggatcatctgcagcattttctctcctgcactccctgctgcccttttatgttcctat 489  Q
    ||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||    
39949129 tggatcacctgcagcactttctctcctgcactccctgctgcccttttatgttcctat 39949073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 332 - 393
Target Start/End: Original strand, 29984836 - 29984897
Alignment:
332 acatctatgaagtgaattggtataaatggaggctctttaaatggagcaaagatgcactcgtt 393  Q
    ||||| |||||||||||||||||||||||||||||| |||| | ||||||||||||||||||    
29984836 acatccatgaagtgaattggtataaatggaggctctctaaaggaagcaaagatgcactcgtt 29984897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 49; Significance: 8e-19; HSPs: 5)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 433 - 489
Target Start/End: Original strand, 33516702 - 33516758
Alignment:
433 tggatcatctgcagcattttctctcctgcactccctgctgcccttttatgttcctat 489  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||    
33516702 tggatcatctgcagcactttctctcctgcactccctgctgcccttttatgtttctat 33516758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 262 - 388
Target Start/End: Complemental strand, 46461999 - 46461865
Alignment:
262 gtgtttatttttcggtaaaataatgctttttctaaacattttactctcagccattgattttatttttgcc---------acatctatgaagtgaattggt 352  Q
    |||||||||||   |||||  |||||||||||||||| ||||| ||||||||||||||||||| ||||||         ||||| ||||| |||| ||||    
46461999 gtgtttattttgtagtaaacaaatgctttttctaaac-ttttaatctcagccattgattttatatttgccacatgtcaaacatccatgaaatgaaatggt 46461901  T
353 ataaatggaggctctttaaatggagcaaagatgcac 388  Q
    ||||||||||||||| | ||||||||||||||||||    
46461900 ataaatggaggctctcttaatggagcaaagatgcac 46461865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 391 - 427
Target Start/End: Complemental strand, 46878752 - 46878716
Alignment:
391 gttttaaacagtgcatgggtagttgaagtaattctta 427  Q
    |||||||| ||||||||||||||||||||||||||||    
46878752 gttttaaatagtgcatgggtagttgaagtaattctta 46878716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 391 - 427
Target Start/End: Complemental strand, 49319607 - 49319571
Alignment:
391 gttttaaacagtgcatgggtagttgaagtaattctta 427  Q
    |||||||| ||||||||||||||||||||||||||||    
49319607 gttttaaatagtgcatgggtagttgaagtaattctta 49319571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 354 - 390
Target Start/End: Original strand, 39232331 - 39232367
Alignment:
354 taaatggaggctctttaaatggagcaaagatgcactc 390  Q
    |||||||||||||| ||||||||||||||||| ||||    
39232331 taaatggaggctctctaaatggagcaaagatggactc 39232367  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 440 - 489
Target Start/End: Complemental strand, 25107650 - 25107601
Alignment:
440 tctgcagcattttctctcctgcactccctgctgcccttttatgttcctat 489  Q
    |||||| || ||||||||||||||||||||||||||||||||||||||||    
25107650 tctgcaacactttctctcctgcactccctgctgcccttttatgttcctat 25107601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 432 - 485
Target Start/End: Complemental strand, 22118774 - 22118720
Alignment:
432 atggatcatctgcagca-ttttctctcctgcactccctgctgcccttttatgttc 485  Q
    |||||||||||||| || |||||||||||||||| |||  |||||||||||||||    
22118774 atggatcatctgcaacacttttctctcctgcacttcctagtgcccttttatgttc 22118720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 450 - 489
Target Start/End: Original strand, 20797086 - 20797125
Alignment:
450 tttctctcctgcactccctgctgcccttttatgttcctat 489  Q
    |||||||||||||||| ||||| |||||||||||||||||    
20797086 tttctctcctgcactctctgcttcccttttatgttcctat 20797125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105744 times since January 2019
Visitors: 1318