View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_19_1 (Length: 441)

Name: 108_19_1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_19_1
108_19_1
[»] chr7 (2 HSPs)
chr7 (196-440)||(45632463-45632707)
chr7 (20-98)||(45632286-45632364)
[»] chr3 (2 HSPs)
chr3 (194-440)||(53159271-53159517)
chr3 (20-98)||(53159611-53159689)
[»] chr6 (2 HSPs)
chr6 (194-438)||(7368784-7369028)
chr6 (20-98)||(7368608-7368686)
[»] chr2 (1 HSPs)
chr2 (210-432)||(39905947-39906168)


Alignment Details
Target: chr7 (Bit Score: 201; Significance: 1e-109; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 196 - 440
Target Start/End: Original strand, 45632463 - 45632707
Alignment:
196 ggggatgctccaagtttgagactccatctgtaactactggcccatggattggaatgaatgacttttttgactcaatatttcttctatggagtggaagact 295  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
45632463 ggggatgctccaagtttgagactgcatctgtaactactggcccatggattggaatgaatgacttttttgactcaatatttcttctatggagtgaaagact 45632562  T
296 taatgcactctatgttccttccttaatttgctgcctttatttangtctttgatattgnattttacggctaagtagttgctccattttttgtcacgttgct 395  Q
    ||||||| ||| ||||||||||||||||| ||||||||||||| ||||||||||||| ||||||||| ||||||||||||||||||||||||||| ||||    
45632563 taatgcattctttgttccttccttaatttactgcctttatttatgtctttgatattgtattttacgggtaagtagttgctccattttttgtcacgctgct 45632662  T
396 aacacaattttgagaagagngtgctctactatatatangaagcat 440  Q
    ||||||||||||||||||| ||| ||||||||||||| |||||||    
45632663 aacacaattttgagaagagtgtgttctactatatatatgaagcat 45632707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 20 - 98
Target Start/End: Original strand, 45632286 - 45632364
Alignment:
20 attaatttactccttaatttattctttaataactagagtgactgtggcagttaaggtgtcgccggtttgacattatggg 98  Q
    |||||||||||| || |||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||    
45632286 attaatttactcattcatttgttctttaataactagagtgaccgtggcagttaaagtgtcgccggtttgacattatggg 45632364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 194 - 440
Target Start/End: Complemental strand, 53159517 - 53159271
Alignment:
194 atggggatgctccaagtttgagactccatctgtaactactggcccatggattggaatgaatgacttttttgactcaatatttcttctatggagtggaaga 293  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
53159517 atggggatgctccaagtttgagactgcatctgtaactactggcccatggattggaatgaatgacttttttgactcaatatttcttctatggagtgaaaga 53159418  T
294 cttaatgcactctatgttccttccttaatttgctgcctttatttangtctttgatattgnattttacggctaagtagttgctccattttttgtcacgttg 393  Q
    ||||||||| ||| ||||||||||||||||||||||||||||||  ||||||||||||| | ||||||||||||||||||||||||||||||||||| ||    
53159417 cttaatgcattctttgttccttccttaatttgctgcctttatttttgtctttgatattgtaatttacggctaagtagttgctccattttttgtcacgctg 53159318  T
394 ctaacacaattttgagaagagngtgctctactatatatangaagcat 440  Q
    ||||||||||||||| ||||| ||| ||||||||||||| |||||||    
53159317 ctaacacaattttgaaaagagtgtgttctactatatatatgaagcat 53159271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 20 - 98
Target Start/End: Complemental strand, 53159689 - 53159611
Alignment:
20 attaatttactccttaatttattctttaataactagagtgactgtggcagttaaggtgtcgccggtttgacattatggg 98  Q
    |||||||||||| || |||| ||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||    
53159689 attaatttactctttcatttgttctttaataactagagtgaccgtggcagttaaagtgtcgccggtttgacattatggg 53159611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 194 - 438
Target Start/End: Original strand, 7368784 - 7369028
Alignment:
194 atggggatgctccaagtttgagactccatctgtaactactggcccatggattggaatgaatgacttttttgactcaatatttcttctatggagtggaaga 293  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| ||||    
7368784 atggggatgctccaagtttgagactgcatctgtaactactggcccatggattggaatgaatgatttttttgactcaatatttcttctctggagtgaaaga 7368883  T
294 cttaatgcactctatgttccttccttaatttgctgcctttatttangtctttgatattgnattttacggctaagtagttgctccattttttgtcacgttg 393  Q
    ||||||||| ||| | |||||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| ||    
7368884 cttaatgcattctttattccttccttaatttgttgcctttatttatgtctttgatattgtattttacggctaagtagttgctccattttttgtcacgctg 7368983  T
394 ctaacacaattttgagaagagngtgctctactatatatangaagc 438  Q
    ||||||||||||||||||||| ||| ||||||||||||| |||||    
7368984 ctaacacaattttgagaagagtgtgttctactatatatatgaagc 7369028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 20 - 98
Target Start/End: Original strand, 7368608 - 7368686
Alignment:
20 attaatttactccttaatttattctttaataactagagtgactgtggcagttaaggtgtcgccggtttgacattatggg 98  Q
    |||||||||||| || |||| |||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||    
7368608 attaatttactctttcatttgttctttaataactatagtgaccgtggcagttaaggtgtcgccggtttgacattatggg 7368686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 106; Significance: 7e-53; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 210 - 432
Target Start/End: Original strand, 39905947 - 39906168
Alignment:
210 tttgagactccatctgtaactactggcccatggattggaatgaatgacttttttgactcaatatttcttctatggagtggaagacttaatgcactctatg 309  Q
    ||||||||| ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||| || ||||||  || ||| ||    
39905947 tttgagactgcatctgtaactactgacccatggattggaatgaatgagttttttgactcaatatttcttctatggagtgaaaaacttaagacattctttg 39906046  T
310 ttccttccttaatttgctgcctttatttangtctttgatattgnattttacggctaagtagttgctccattttttgtcacgttgctaacacaattttgag 409  Q
    ||  |||||||||||| || |||| || | ||||||||||||| | ||||||||||||| |||||||||||| || |||||  | ||||||| |||||||    
39906047 ttggttccttaatttgttgtctttgttcatgtctttgatattgta-tttacggctaagtggttgctccatttgttctcacgcgggtaacacacttttgag 39906145  T
410 aagagngtgctctactatatata 432  Q
    || || | | |||||||||||||    
39906146 aatagtgcgttctactatatata 39906168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 204773 times since January 2019
Visitors: 1518