View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_19_16 (Length: 429)

Name: 108_19_16
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_19_16
108_19_16
[»] chr3 (1 HSPs)
chr3 (1-420)||(52584059-52584477)


Alignment Details
Target: chr3 (Bit Score: 386; Significance: 0; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 386; E-Value: 0
Query Start/End: Original strand, 1 - 420
Target Start/End: Complemental strand, 52584477 - 52584059
Alignment:
1 ctgagatgagtcacacaagacatttgatggatctacttggtgcagcaaacgagaataatcaccagacacaacaaggcctatccctttctttaggctctca 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52584477 ctgagatgagtcacacaagacatttgatggatctacttggtgcagcaaacgagaataatcaccagacacaacaaggcctatccctttctttaggctctca 52584378  T
101 catgcttgttgatgaatacagaaaccgttccttaaatcaaggtcttatgatcaatccaagttacttcatgcctggtcaagatcagacacgtgagccttgt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52584377 catgcttgttgatgaatacagaaaccgttccttaaatcaaggtcttatgatcaatccaagttacttcatgcctggtcaagatcagacacgtgagccttgt 52584278  T
201 aatcaacctgtggtggagaatctaacaagtgattattttttcagtggtggaagtggaacttttgcttcaggttctaataataataactcattattattga 300  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52584277 aatcaacctgtggtggagaatctaactagtgattattttttcagtggtggaagtggaacttttgcttcaggttctaataataataactcattattattga 52584178  T
301 accgttctacttctacttcttatggaagtgagagttttggttccgttattggganctctagataccttaaaccngtacagtcacttcntgaagatcntgn 400  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||| ||||||||||||| |||||||| ||     
52584177 accgttctacttctacttcttatggaagtgagagttttggttctgttattgggaactctagataccttaaaccagtacagtcacttcttgaagatcttgt 52584078  T
401 tgatgtttggnggaaatgtg 420  Q
    ||||| |||| |||||||||    
52584077 tgatg-ttggtggaaatgtg 52584059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106105 times since January 2019
Visitors: 1319