View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_20_59 (Length: 265)

Name: 108_20_59
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_20_59
108_20_59
[»] chr5 (1 HSPs)
chr5 (1-93)||(12038419-12038510)


Alignment Details
Target: chr5 (Bit Score: 82; Significance: 8e-39; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 12038510 - 12038419
Alignment:
1 gatacgtgggaagatcttcgtaatagatatacctgaaactttgtagaaacatcttctctatgtgaggttctggnttgcagaatcgagccntcg 93  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||    
12038510 gatacgtgggaagatcttcgtaatagatatacctgaaactttgtagaaacatcttctctatgtgaggttctgg-ttgcagaatcgagccctcg 12038419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176091 times since January 2019
Visitors: 1578