View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_21_1 (Length: 484)

Name: 108_21_1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_21_1
108_21_1
[»] chr1 (2 HSPs)
chr1 (1-359)||(9630192-9630548)
chr1 (359-460)||(9629574-9629672)
[»] chr3 (1 HSPs)
chr3 (192-312)||(41257575-41257695)


Alignment Details
Target: chr1 (Bit Score: 307; Significance: 1e-173; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 359
Target Start/End: Original strand, 9630192 - 9630548
Alignment:
1 aaaacttaacctcaacatcagcaaccgaagacgttgnantttccgacaagttcgttgatgttgtcgttgatcgaagangctgaanaagttgnagatggct 100  Q
    |||||||||||||||||||||||||| ||||||||| | |||||||||||||||||||||||||||||||||||||| |||||| |||||| ||||||||    
9630192 aaaacttaacctcaacatcagcaaccaaagacgttgaa-tttccgacaagttcgttgatgttgtcgttgatcgaagaagctgaagaagttggagatggct 9630290  T
101 cagatgaaaggtaaccaccacattgttgcaaccattggtatggagttcttggactaattgggaagattattctaggacttggtggtaaaggtcttggact 200  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9630291 cagatgaaaggtaaccaccacattgttgcaaccattgggatggagttcttggactaattgggaagattattctaggacttggtggtaaaggtcttggact 9630390  T
201 tggtacttcattgtaaacttttctttgtttcttggattctaggcattgtagtagttgangtaactcgttgatgtaatcnattacactttcnactattgat 300  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |||||||||    
9630391 tggtacttcattgtaaacttttctttgtttcttggattctaggcattgtagtagttgatgtaactcgttgatgtaatcaattacactttcaactattgat 9630490  T
301 gcttgatctcccctaaaccatataggagagtaattagttgcatttttcntaccaaaaaa 359  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||| ||| ||||||    
9630491 gcttgatct-ccctaaaccatataggagagtaattagttgcatttttcatacaaaaaaa 9630548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 359 - 460
Target Start/End: Original strand, 9629574 - 9629672
Alignment:
359 attaatggaccgaanttgaaaacataaataacaattancacacatganncntgcatactcnaatcattagctgctatgaanttaaataanccatattgga 458  Q
    ||||||||||| || ||||||||||||||||| |||| |||||||||  | ||||||||| ||||||||||||||||||| |||||||| | ||||||||    
9629574 attaatggaccaaaattgaaaacataaataac-attaacacacatgatacatgcatactc-aatcattagctgctatgaa-ttaaataaacaatattgga 9629670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 192 - 312
Target Start/End: Complemental strand, 41257695 - 41257575
Alignment:
192 tcttggacttggtacttcattgtaaacttttctttgtttcttggattctaggcattgtagtagttgangtaactcgttgatgtaatcnattacactttcn 291  Q
    |||||||||| |||||||| |||| ||||||||||||||||||| ||| |||  ||| ||||||||  | |||||  |||||||||| | ||||| | |     
41257695 tcttggacttagtacttcactgtatacttttctttgtttcttggcttcaagggcttggagtagttgttgcaactctgtgatgtaatcaactacacctcca 41257596  T
292 actattgatgcttgatctccc 312  Q
    | |||||||||||||||||||    
41257595 attattgatgcttgatctccc 41257575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175858 times since January 2019
Visitors: 1577