View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_21_11 (Length: 415)

Name: 108_21_11
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_21_11
108_21_11
[»] chr1 (41 HSPs)
chr1 (1-415)||(9629761-9630196)
chr1 (186-282)||(36878417-36878514)
chr1 (206-281)||(398772-398847)
chr1 (186-335)||(5898209-5898368)
chr1 (186-273)||(14359537-14359623)
chr1 (206-301)||(20157338-20157432)
chr1 (206-275)||(16927198-16927267)
chr1 (229-282)||(38503320-38503373)
chr1 (207-282)||(1486715-1486790)
chr1 (206-281)||(7918218-7918293)
chr1 (207-281)||(17754289-17754363)
chr1 (232-282)||(52903252-52903302)
chr1 (229-282)||(9828044-9828097)
chr1 (206-275)||(34298413-34298482)
chr1 (183-282)||(24577192-24577292)
chr1 (186-282)||(28273094-28273190)
chr1 (229-308)||(113299-113382)
chr1 (229-268)||(2896141-2896180)
chr1 (286-333)||(9828122-9828169)
chr1 (224-267)||(11605956-11605999)
chr1 (229-280)||(17425101-17425152)
chr1 (207-286)||(22794080-22794159)
chr1 (229-280)||(25098563-25098614)
chr1 (186-273)||(27471581-27471668)
chr1 (230-280)||(6427351-6427401)
chr1 (229-283)||(17831536-17831590)
chr1 (228-262)||(22781441-22781475)
chr1 (228-282)||(34371713-34371766)
chr1 (229-275)||(40181871-40181917)
chr1 (237-282)||(1864886-1864931)
chr1 (230-267)||(2851022-2851059)
chr1 (229-286)||(12443462-12443519)
chr1 (233-282)||(44482234-44482283)
chr1 (229-282)||(46348389-46348442)
chr1 (227-275)||(48148050-48148099)
chr1 (206-262)||(5927366-5927422)
chr1 (230-282)||(9709821-9709873)
chr1 (230-282)||(24176373-24176425)
chr1 (229-281)||(25361886-25361938)
chr1 (230-282)||(31015044-31015096)
chr1 (186-282)||(48450593-48450689)
[»] chr6 (45 HSPs)
chr6 (224-333)||(9025450-9025558)
chr6 (209-280)||(10888982-10889053)
chr6 (206-325)||(9027155-9027273)
chr6 (186-286)||(2117034-2117133)
chr6 (206-282)||(7086772-7086848)
chr6 (229-333)||(7938116-7938214)
chr6 (209-282)||(30866150-30866223)
chr6 (230-282)||(7265599-7265651)
chr6 (206-274)||(8805586-8805654)
chr6 (206-282)||(13851713-13851789)
chr6 (229-281)||(17341671-17341723)
chr6 (229-281)||(19040352-19040404)
chr6 (206-277)||(7625099-7625170)
chr6 (229-333)||(7996327-7996437)
chr6 (229-333)||(8022364-8022474)
chr6 (185-280)||(32511674-32511769)
chr6 (188-282)||(16833267-16833361)
chr6 (230-275)||(1532241-1532286)
chr6 (206-275)||(3398596-3398664)
chr6 (206-275)||(9658856-9658925)
chr6 (229-282)||(20371116-20371169)
chr6 (186-282)||(10770680-10770776)
chr6 (186-282)||(19147799-19147895)
chr6 (234-286)||(24832593-24832645)
chr6 (235-333)||(31959165-31959264)
chr6 (228-275)||(32320682-32320729)
chr6 (290-333)||(32978844-32978887)
chr6 (215-286)||(34446551-34446622)
chr6 (215-265)||(7723273-7723323)
chr6 (195-273)||(12696290-12696368)
chr6 (230-280)||(13689500-13689550)
chr6 (207-273)||(25038086-25038152)
chr6 (230-268)||(34447378-34447416)
chr6 (237-286)||(6389751-6389800)
chr6 (229-282)||(7377979-7378032)
chr6 (229-282)||(10842532-10842585)
chr6 (229-282)||(13364711-13364764)
chr6 (229-282)||(16766697-16766750)
chr6 (237-286)||(17168465-17168514)
chr6 (229-282)||(21924941-21924994)
chr6 (229-282)||(26562689-26562742)
chr6 (186-282)||(34595090-34595187)
chr6 (276-308)||(7930358-7930390)
chr6 (236-276)||(8389484-8389524)
chr6 (230-274)||(31579239-31579283)
[»] chr7 (37 HSPs)
chr7 (206-282)||(21140988-21141064)
chr7 (187-282)||(15902780-15902875)
chr7 (206-275)||(5235963-5236032)
chr7 (209-282)||(20549771-20549844)
chr7 (206-266)||(26733281-26733341)
chr7 (218-281)||(17851420-17851483)
chr7 (215-281)||(42720897-42720963)
chr7 (209-282)||(3520348-3520421)
chr7 (237-286)||(23751908-23751957)
chr7 (229-274)||(29787383-29787428)
chr7 (229-281)||(5548676-5548728)
chr7 (206-282)||(19206027-19206103)
chr7 (229-281)||(32308120-32308172)
chr7 (206-282)||(49107798-49107873)
chr7 (286-333)||(598275-598322)
chr7 (286-333)||(9778572-9778619)
chr7 (186-306)||(12289070-12289189)
chr7 (237-286)||(5938480-5938529)
chr7 (220-273)||(11831423-11831476)
chr7 (237-274)||(11890933-11890970)
chr7 (236-273)||(13300417-13300454)
chr7 (225-274)||(14729697-14729746)
chr7 (235-308)||(18215167-18215239)
chr7 (229-282)||(19992001-19992054)
chr7 (229-282)||(24339642-24339695)
chr7 (237-286)||(29812666-29812715)
chr7 (234-274)||(2424619-2424659)
chr7 (186-285)||(4017797-4017897)
chr7 (237-285)||(8239053-8239101)
chr7 (190-265)||(11722121-11722197)
chr7 (206-282)||(22602716-22602792)
chr7 (229-281)||(22868042-22868094)
chr7 (229-273)||(23191896-23191940)
chr7 (229-273)||(25481902-25481946)
chr7 (206-282)||(26329388-26329464)
chr7 (206-282)||(27945018-27945094)
chr7 (187-286)||(43249950-43250050)
[»] scaffold0020 (1 HSPs)
scaffold0020 (207-308)||(135293-135393)
[»] chr3 (36 HSPs)
chr3 (215-276)||(23870571-23870632)
chr3 (179-282)||(26508060-26508163)
chr3 (229-282)||(8383257-8383310)
chr3 (209-286)||(34307782-34307859)
chr3 (230-282)||(17005625-17005677)
chr3 (229-307)||(13620744-13620823)
chr3 (229-282)||(7928450-7928503)
chr3 (201-282)||(11658787-11658868)
chr3 (230-282)||(8039841-8039893)
chr3 (215-263)||(15544679-15544727)
chr3 (215-275)||(29112293-29112353)
chr3 (186-273)||(26492220-26492307)
chr3 (236-282)||(29508451-29508497)
chr3 (291-333)||(29508522-29508564)
chr3 (206-282)||(11665921-11665997)
chr3 (201-301)||(14223841-14223940)
chr3 (230-281)||(1550141-1550192)
chr3 (237-300)||(25892468-25892530)
chr3 (229-275)||(10690275-10690321)
chr3 (216-266)||(21257008-21257058)
chr3 (237-287)||(25652032-25652082)
chr3 (186-282)||(40993341-40993432)
chr3 (215-281)||(49505161-49505227)
chr3 (237-286)||(15864841-15864890)
chr3 (286-331)||(15999957-16000002)
chr3 (219-280)||(16192758-16192819)
chr3 (209-282)||(22774076-22774149)
chr3 (235-280)||(25948895-25948940)
chr3 (229-286)||(35994740-35994796)
chr3 (229-273)||(4987306-4987350)
chr3 (230-333)||(11610522-11610623)
chr3 (237-273)||(15796309-15796345)
chr3 (206-286)||(24205043-24205123)
chr3 (206-274)||(25064886-25064954)
chr3 (229-281)||(32804547-32804599)
chr3 (228-268)||(51206373-51206413)
[»] chr8 (29 HSPs)
chr8 (207-281)||(24362209-24362283)
chr8 (215-282)||(34897071-34897138)
chr8 (206-282)||(12570514-12570590)
chr8 (206-286)||(39820406-39820486)
chr8 (195-282)||(24669399-24669486)
chr8 (235-281)||(3025557-3025603)
chr8 (215-285)||(3658133-3658203)
chr8 (237-282)||(11927092-11927137)
chr8 (229-282)||(12606835-12606888)
chr8 (228-268)||(18067954-18067994)
chr8 (215-275)||(39954292-39954352)
chr8 (206-273)||(4673440-4673507)
chr8 (206-273)||(8343293-8343360)
chr8 (229-275)||(4611534-4611580)
chr8 (212-282)||(20679401-20679471)
chr8 (228-282)||(25566840-25566894)
chr8 (206-280)||(36934647-36934721)
chr8 (237-282)||(11944673-11944718)
chr8 (214-275)||(12570747-12570808)
chr8 (229-282)||(13844602-13844655)
chr8 (229-282)||(31236583-31236636)
chr8 (206-282)||(2572062-2572138)
chr8 (228-264)||(18069155-18069191)
chr8 (289-333)||(22652057-22652101)
chr8 (206-302)||(22850321-22850416)
chr8 (229-281)||(27101515-27101566)
chr8 (187-275)||(29775994-29776082)
chr8 (211-275)||(34201059-34201123)
chr8 (234-282)||(34222952-34223000)
[»] chr5 (33 HSPs)
chr5 (232-286)||(5467980-5468034)
chr5 (206-287)||(25863181-25863262)
chr5 (229-282)||(28588680-28588733)
chr5 (212-275)||(12927637-12927700)
chr5 (186-333)||(2436878-2437025)
chr5 (229-282)||(3966503-3966556)
chr5 (222-275)||(10022625-10022678)
chr5 (206-287)||(14574051-14574131)
chr5 (229-282)||(23220983-23221036)
chr5 (228-280)||(6471897-6471949)
chr5 (209-281)||(27144443-27144515)
chr5 (230-282)||(30502394-30502446)
chr5 (230-282)||(30542737-30542789)
chr5 (212-280)||(39205863-39205931)
chr5 (229-333)||(39695956-39696058)
chr5 (206-282)||(23015995-23016073)
chr5 (231-282)||(34879352-34879403)
chr5 (206-273)||(42488068-42488135)
chr5 (225-275)||(17593735-17593785)
chr5 (227-281)||(25817493-25817547)
chr5 (215-273)||(39698527-39698585)
chr5 (209-262)||(7175045-7175098)
chr5 (237-286)||(7997168-7997217)
chr5 (215-268)||(19438329-19438382)
chr5 (229-282)||(21191062-21191115)
chr5 (228-281)||(32630742-32630795)
chr5 (229-282)||(41091263-41091316)
chr5 (237-286)||(43554529-43554578)
chr5 (209-281)||(19168828-19168900)
chr5 (230-282)||(21576751-21576803)
chr5 (229-273)||(27932235-27932279)
chr5 (230-282)||(36838544-36838596)
chr5 (236-307)||(38464344-38464416)
[»] chr2 (38 HSPs)
chr2 (232-282)||(34691811-34691861)
chr2 (232-282)||(34714223-34714273)
chr2 (229-282)||(37411250-37411303)
chr2 (206-273)||(12940950-12941017)
chr2 (206-280)||(21616739-21616813)
chr2 (209-282)||(23718006-23718079)
chr2 (209-282)||(24105678-24105751)
chr2 (206-282)||(20539680-20539756)
chr2 (186-282)||(30404856-30404952)
chr2 (186-281)||(27286299-27286394)
chr2 (215-282)||(29970555-29970622)
chr2 (229-275)||(28677909-28677955)
chr2 (215-281)||(31808063-31808129)
chr2 (228-282)||(44860319-44860373)
chr2 (209-286)||(23354654-23354731)
chr2 (237-286)||(25544489-25544538)
chr2 (229-333)||(42832237-42832335)
chr2 (206-274)||(21782832-21782900)
chr2 (230-274)||(28412351-28412395)
chr2 (221-268)||(22084852-22084899)
chr2 (229-268)||(24975345-24975384)
chr2 (207-282)||(36756350-36756425)
chr2 (236-307)||(18622613-18622690)
chr2 (229-266)||(1327978-1328015)
chr2 (229-274)||(16069268-16069313)
chr2 (229-274)||(18276521-18276566)
chr2 (229-286)||(19573978-19574035)
chr2 (237-282)||(30527601-30527646)
chr2 (210-282)||(4882702-4882774)
chr2 (232-264)||(6045940-6045972)
chr2 (229-265)||(8950338-8950374)
chr2 (229-285)||(10535762-10535818)
chr2 (186-282)||(18841019-18841115)
chr2 (231-275)||(25080902-25080946)
chr2 (230-282)||(31018591-31018643)
chr2 (242-282)||(38355893-38355933)
chr2 (230-282)||(39279676-39279728)
chr2 (229-273)||(39323264-39323308)
[»] chr4 (28 HSPs)
chr4 (229-333)||(37203264-37203366)
chr4 (229-335)||(3712456-3712568)
chr4 (186-286)||(22440602-22440702)
chr4 (206-301)||(24343484-24343578)
chr4 (215-265)||(56488533-56488583)
chr4 (206-295)||(14126104-14126193)
chr4 (235-311)||(35952588-35952670)
chr4 (188-278)||(7012025-7012115)
chr4 (229-275)||(8423731-8423777)
chr4 (224-274)||(56257928-56257978)
chr4 (229-282)||(40613450-40613503)
chr4 (209-244)||(35160982-35161017)
chr4 (230-280)||(36635325-36635375)
chr4 (209-275)||(40179649-40179715)
chr4 (236-282)||(54580029-54580075)
chr4 (229-282)||(999354-999407)
chr4 (216-285)||(19230312-19230381)
chr4 (186-282)||(21945459-21945556)
chr4 (209-282)||(26504305-26504378)
chr4 (224-273)||(28964263-28964312)
chr4 (186-282)||(49430982-49431079)
chr4 (231-275)||(903924-903968)
chr4 (230-274)||(16189710-16189754)
chr4 (281-325)||(21873315-21873359)
chr4 (281-325)||(21929176-21929220)
chr4 (230-282)||(29205445-29205497)
chr4 (235-275)||(30838216-30838256)
chr4 (229-273)||(38847027-38847071)
[»] scaffold0022 (1 HSPs)
scaffold0022 (206-275)||(90820-90889)
[»] scaffold1528 (1 HSPs)
scaffold1528 (207-281)||(1013-1087)
[»] scaffold0123 (1 HSPs)
scaffold0123 (228-282)||(44531-44585)
[»] scaffold0044 (2 HSPs)
scaffold0044 (286-331)||(53258-53303)
scaffold0044 (232-282)||(53183-53233)
[»] scaffold0024 (1 HSPs)
scaffold0024 (221-281)||(68249-68309)
[»] scaffold0003 (2 HSPs)
scaffold0003 (286-333)||(241672-241719)
scaffold0003 (186-274)||(241550-241639)
[»] scaffold0085 (1 HSPs)
scaffold0085 (209-283)||(26373-26447)
[»] scaffold0050 (1 HSPs)
scaffold0050 (190-282)||(70238-70331)
[»] scaffold0223 (1 HSPs)
scaffold0223 (229-273)||(20172-20216)
[»] scaffold0103 (1 HSPs)
scaffold0103 (229-273)||(51811-51855)
[»] scaffold0053 (1 HSPs)
scaffold0053 (206-282)||(8775-8851)
[»] scaffold0004 (1 HSPs)
scaffold0004 (229-273)||(92807-92851)


Alignment Details
Target: chr1 (Bit Score: 245; Significance: 1e-136; HSPs: 41)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 415
Target Start/End: Complemental strand, 9630196 - 9629761
Alignment:
1 gttttgtggttcacatgtgcttttgaaaaccgtttcgtcgcgaattccggggcaggctcttagaataatgtctgttcttgaagatctaaggcttgagatt 100  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9630196 gttttgtggttcacatgtgcttttgaaaaccgtttcgtcacgaattccggggcaggctcttagaataatgtctgttcttgaagatctaaggcttgagatt 9630097  T
101 gttcatgttagagttaatactgctgatgaaaccatgctatacttgttcactattaaggtaacttaatc---------ttttttctgattacacactatga 191  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||         ||||||||| |||||||||||||    
9630096 gttcatgttagagttaatactgctgatgaaaccatgctatacttgtttactattaaggtaacttaatctttgtgtatttttttctggttacacactatga 9629997  T
192 agcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattata------ggtgtcgtgt 285  Q
    |||||||| ||||||||||||  ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||      ||||||||||    
9629996 agcacggatacggccacgacatggacaccgacacatcgacaccgctaataatttgataaaatcatataattcagtgtgattataagtgtcggtgtcgtgt 9629897  T
286 ---------------cacgtgtccgacaccgggacacgtctcgtccaagaagtgtccgtgctttacaccgttagtgaagnacattactactgccctgtat 370  Q
                   ||| |||||||||||||||||||||||||||||||||||||||||| |||||| | |||||||| |||||||||     ||||||    
9629896 cgatgtcggacacgacacatgtccgacaccgggacacgtctcgtccaagaagtgtccgtgc-ttacacag-tagtgaagtacattacta-----ctgtat 9629804  T
371 agtataaataactaatcaatgacatgccagtacccaaagcatctt 415  Q
    ||||| |||||||||||||||||||| |||||| |||||||||||    
9629803 agtat-aataactaatcaatgacatg-cagtacacaaagcatctt 9629761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 186 - 282
Target Start/End: Original strand, 36878417 - 36878514
Alignment:
186 ctatgaagcacggagacggccacg-acacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||||| |||| |||| ||| |||||| |||||   ||||||||||||||||||| ||||||| |||||||||||| |||||||||||||    
36878417 ctatgaagcacggatacggacacggacatagacactgacacgccgacaccgctaataatttgagaaaatcacataattcagtgtaattataggtgtcg 36878514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 206 - 281
Target Start/End: Complemental strand, 398847 - 398772
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    |||||||| ||||| |||||   ||||||||||||||||||| ||||||| |||||||||||| ||||||||||||    
398847 cacgacacggacactgacacgccgacaccgctaataatttgaaaaaatcacataattcagtgtaattataggtgtc 398772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 186 - 335
Target Start/End: Complemental strand, 5898368 - 5898209
Alignment:
186 ctatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc-gtg 284  Q
    ||||| |||||||| |||| || ||||||||||| || ||   ||||||||||||||| ||| ||||||| |||||||||||| |||||| | ||| |||    
5898368 ctatgtagcacggatacggacatgacacagacactgagacgccgacaccgctaataatctgaaaaaatcacataattcagtgtaattatatgcgtcggtg 5898269  T
285 t---------cacgtgtccgacaccgggacacgtctcgtccaagaagtgtccgtgcttta 335  Q
    |         ||||||||| ||||||||||||||||  ||| || |||||||||||||||    
5898268 tcagacacgacacgtgtccaacaccgggacacgtctaatccgaggagtgtccgtgcttta 5898209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 186 - 273
Target Start/End: Complemental strand, 14359623 - 14359537
Alignment:
186 ctatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    |||||||||||||| |||| |||||||||||||| |||||   ||||| ||||||||||||| ||||||| |||||| ||||| ||||    
14359623 ctatgaagcacggatacggacacgacacagacacggacacgccgacacagctaataatttga-aaaatcacataatttagtgtaatta 14359537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 206 - 301
Target Start/End: Complemental strand, 20157432 - 20157338
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtcacgtgtccgacaccg 301  Q
    |||||||| | ||| ||||||| ||||||||||||||| ||| ||||||| |||||||||||| || ||| |||||| ||  ||||||||||||||    
20157432 cacgacacgggcactgacacatcgacaccgctaataatgtgagaaaatcacataattcagtgtaatcatatgtgtcg-gtgtcgtgtccgacaccg 20157338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 206 - 275
Target Start/End: Complemental strand, 16927267 - 16927198
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    |||||||||||||| ||||| | | ||  ||||||||||||| |||||||||||||||||||| ||||||    
16927267 cacgacacagacactgacacgtcggcatagctaataatttgaaaaaatcatataattcagtgtaattata 16927198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 229 - 282
Target Start/End: Original strand, 38503320 - 38503373
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||||||||||| ||||||||||| |||||||| |||||| ||||||    
38503320 gacaccgctaataatttgagaaaatcatatatttcagtgtaattatatgtgtcg 38503373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 207 - 282
Target Start/End: Complemental strand, 1486790 - 1486715
Alignment:
207 acgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||| || || |||||  |||||| ||||||||||||| ||||||| |||||||||||| |||||| ||||||    
1486790 acgacacggatactgacacgctgacacagctaataatttgaaaaaatcacataattcagtgtaattataagtgtcg 1486715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 206 - 281
Target Start/End: Complemental strand, 7918293 - 7918218
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    |||||||||||||  |||||  ||||| | |||||||||||| ||||||| |||||||||||| |||||| |||||    
7918293 cacgacacagacaatgacacgctgacatcactaataatttgagaaaatcacataattcagtgtaattatatgtgtc 7918218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 207 - 281
Target Start/End: Original strand, 17754289 - 17754363
Alignment:
207 acgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    ||||||||||| | ||||||  ||||||||||||||||||| ||||| | |||||||||||| | |||| |||||    
17754289 acgacacagacgctgacacaccgacaccgctaataatttgaaaaaattacataattcagtgtaactatatgtgtc 17754363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 232 - 282
Target Start/End: Original strand, 52903252 - 52903302
Alignment:
232 accgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||| ||||||||| |||||||||||||||||||||| |||||| ||||||    
52903252 accgttaataatttaataaaatcatataattcagtgtaattatatgtgtcg 52903302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 229 - 282
Target Start/End: Original strand, 9828044 - 9828097
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||| |||||||||||||||||||| |||||||||||| ||| || ||||||    
9828044 gacaccactaataatttgataaaatcacataattcagtgtaattttatgtgtcg 9828097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 206 - 275
Target Start/End: Original strand, 34298413 - 34298482
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    |||||||| || || ||||||  |||||| |||||||||||| ||||||| |||||||||||| ||||||    
34298413 cacgacacggaaactgacacaccgacaccactaataatttgagaaaatcacataattcagtgtaattata 34298482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 183 - 282
Target Start/End: Complemental strand, 24577292 - 24577192
Alignment:
183 acactatgaagcacggagacggccacgacaca-gacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    ||||||||||||||||| |||| |||   ||| ||||| |||||  ||||||  |||||||||||| ||||||| |||||||||||| |||| | |||||    
24577292 acactatgaagcacggatacggacactgaacacgacacggacacgctgacacaactaataatttgaaaaaatcacataattcagtgtaattacaagtgtc 24577193  T
282 g 282  Q
    |    
24577192 g 24577192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 282
Target Start/End: Complemental strand, 28273190 - 28273094
Alignment:
186 ctatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||||| |||| || ||||  ||||| ||||   ||||||  ||||| |||||| |||||||||||||||||||| |||| | ||||||    
28273190 ctatgaagcacggatacggacatgacaaggacactgacatgctgacacaactaatcatttgaaaaaatcatataattcagtgtaattacaagtgtcg 28273094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 229 - 308
Target Start/End: Original strand, 113299 - 113382
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgatta------taggtgtcgtgtcacgtgtccgacaccgggacacg 308  Q
    ||||| ||||||||||||| ||||||| |||||||||||| ||||      ||||||||||||  ||||||| |||||||||||||    
113299 gacacagctaataatttgaaaaaatcacataattcagtgtaattacaagtgtaggtgtcgtgt--cgtgtccaacaccgggacacg 113382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 229 - 268
Target Start/End: Complemental strand, 2896180 - 2896141
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgt 268  Q
    ||||||||||||||||||| ||||||| ||||||||||||    
2896180 gacaccgctaataatttgagaaaatcacataattcagtgt 2896141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 286 - 333
Target Start/End: Original strand, 9828122 - 9828169
Alignment:
286 cacgtgtccgacaccgggacacgtctcgtccaagaagtgtccgtgctt 333  Q
    ||||||||||||||||||||||||||  ||| || |||||||||||||    
9828122 cacgtgtccgacaccgggacacgtctaatccgaggagtgtccgtgctt 9828169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 224 - 267
Target Start/End: Complemental strand, 11605999 - 11605956
Alignment:
224 acattgacaccgctaataatttgataaaatcatataattcagtg 267  Q
    |||| |||| |||||||||||||| |||||||||||||||||||    
11605999 acatcgacatcgctaataatttgaaaaaatcatataattcagtg 11605956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 229 - 280
Target Start/End: Complemental strand, 17425152 - 17425101
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgt 280  Q
    ||||||| ||||||||||||||||||| |||||||| ||| |||||| ||||    
17425152 gacaccgataataatttgataaaatcacataattcaatgtaattatatgtgt 17425101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 286
Target Start/End: Complemental strand, 22794159 - 22794080
Alignment:
207 acgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    |||||| |||||| ||||| |  |||| | ||||||||||| ||||| | ||||| |||||| |||||||||||||||||    
22794159 acgacatagacactgacacgtcaacacggataataatttgaaaaaatgacataatacagtgtaattataggtgtcgtgtc 22794080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 229 - 280
Target Start/End: Complemental strand, 25098614 - 25098563
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgt 280  Q
    ||||||||| ||||||||| ||||||| |||||||||||| |||||| ||||    
25098614 gacaccgctgataatttgagaaaatcacataattcagtgtaattatatgtgt 25098563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 186 - 273
Target Start/End: Complemental strand, 27471668 - 27471581
Alignment:
186 ctatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    |||||||||||  | |||| | ||||||| |||| ||||||  || |||||||||||||||| |||| || |||||||||||| ||||    
27471668 ctatgaagcacatatacggacgcgacacaaacactgacacaccgataccgctaataatttgagaaaagcacataattcagtgtaatta 27471581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 230 - 280
Target Start/End: Original strand, 6427351 - 6427401
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattataggtgt 280  Q
    |||||||||||||||||| ||||||| |||||||| ||| |||||| ||||    
6427351 acaccgctaataatttgagaaaatcacataattcaatgtaattatatgtgt 6427401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 229 - 283
Target Start/End: Complemental strand, 17831590 - 17831536
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgt 283  Q
    ||||||||||||||||||| ||||||| || ||||||||| || ||| |||||||    
17831590 gacaccgctaataatttgagaaaatcacattattcagtgtaatcatatgtgtcgt 17831536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 228 - 262
Target Start/End: Original strand, 22781441 - 22781475
Alignment:
228 tgacaccgctaataatttgataaaatcatataatt 262  Q
    |||||||||||||||||| ||||||||||||||||    
22781441 tgacaccgctaataattttataaaatcatataatt 22781475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 228 - 282
Target Start/End: Original strand, 34371713 - 34371766
Alignment:
228 tgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||||||||| || ||||||| |||||||||||| |||||| ||||||    
34371713 tgacaccgctaataatt-gagaaaatcacataattcagtgtaattatatgtgtcg 34371766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 229 - 275
Target Start/End: Original strand, 40181871 - 40181917
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    ||||| ||||||||||||| ||||||| |||||||||||| ||||||    
40181871 gacactgctaataatttgagaaaatcacataattcagtgtaattata 40181917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 282
Target Start/End: Complemental strand, 1864931 - 1864886
Alignment:
237 taataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||| ||||||| |||||||||||| |||||| ||||||    
1864931 taataatttgagaaaatcacataattcagtgtaattatatgtgtcg 1864886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 230 - 267
Target Start/End: Original strand, 2851022 - 2851059
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtg 267  Q
    |||||||||||||||||||||||| | |||||||||||    
2851022 acaccgctaataatttgataaaattacataattcagtg 2851059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 286
Target Start/End: Complemental strand, 12443519 - 12443462
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    ||||| ||||||||||||| ||||||| |||||||||||| ||| || ||| ||||||    
12443519 gacacagctaataatttgagaaaatcacataattcagtgtaattgtatgtgacgtgtc 12443462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 233 - 282
Target Start/End: Original strand, 44482234 - 44482283
Alignment:
233 ccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||||||||| ||||||| |||||||||||| |||||| ||||||    
44482234 ccgcttataatttgagaaaatcacataattcagtgtaattatatgtgtcg 44482283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 282
Target Start/End: Complemental strand, 46348442 - 46348389
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||||||||||||| |||||||||||||| ||||| |||| | ||||||    
46348442 gacacagctaataatttgaaaaaatcatataatttagtgtaattacaagtgtcg 46348389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 227 - 275
Target Start/End: Complemental strand, 48148099 - 48148050
Alignment:
227 ttgacaccgctaataatttgataaaa-tcatataattcagtgtgattata 275  Q
    ||||||||||||||||||| | |||| |||||||||||||||| ||||||    
48148099 ttgacaccgctaataattttaaaaaaatcatataattcagtgtaattata 48148050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 206 - 262
Target Start/End: Complemental strand, 5927422 - 5927366
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataatt 262  Q
    |||||||| ||||| |||||  | |||| ||||||||||||| ||||||||||||||    
5927422 cacgacacggacactgacacgctaacactgctaataatttgaaaaaatcatataatt 5927366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 230 - 282
Target Start/End: Original strand, 9709821 - 9709873
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||||||||| ||||||| |||||||  ||| |||||| ||||||    
9709821 acaccgctaataatttgagaaaatcacataattcgttgtaattatatgtgtcg 9709873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 230 - 282
Target Start/End: Complemental strand, 24176425 - 24176373
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||| ||||||||||| ||||| | || ||||||||| |||||||||||||    
24176425 acaccgataataatttgagaaaataacatcattcagtgtaattataggtgtcg 24176373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 281
Target Start/End: Original strand, 25361886 - 25361938
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    |||||| || ||||||||| ||||||| |||||||||||| |||||| |||||    
25361886 gacaccactgataatttgagaaaatcacataattcagtgtaattatatgtgtc 25361938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 230 - 282
Target Start/End: Original strand, 31015044 - 31015096
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||| ||||||||||||| ||||||| |||||||||||| |||| | ||||||    
31015044 acacagctaataatttgagaaaatcacataattcagtgtaattacaagtgtcg 31015096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 282
Target Start/End: Complemental strand, 48450689 - 48450593
Alignment:
186 ctatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||| ||| |||| |||||||| ||||| |||||    |||| ||||||||||||| ||||| | |||||| ||||| |||| | ||||||    
48450689 ctatgaagcatggatacggacacgacacggacactgacacgccaacacagctaataatttgaaaaaataacataatttagtgtaattacaagtgtcg 48450593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 54; Significance: 7e-22; HSPs: 45)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 224 - 333
Target Start/End: Complemental strand, 9025558 - 9025450
Alignment:
224 acattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtcacgtgtccgacaccgggacacgtctcgtccaagaagt 323  Q
    |||| ||||| ||||||||||||| ||||||| |||||||||||| |||||| |||||| ||  ||||||||||||||||||||| ||  ||| ||||||    
9025558 acatggacactgctaataatttgagaaaatcacataattcagtgtaattatatgtgtcg-gtgtcgtgtccgacaccgggacacgcctaatccgagaagt 9025460  T
324 gtccgtgctt 333  Q
    ||||||||||    
9025459 gtccgtgctt 9025450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 209 - 280
Target Start/End: Complemental strand, 10889053 - 10888982
Alignment:
209 gacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgt 280  Q
    ||||| ||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||||| ||||    
10889053 gacacggacaccgacacatagacaccgctaataatttgataaaatcacataatttagtgtgattatatgtgt 10888982  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 206 - 325
Target Start/End: Original strand, 9027155 - 9027273
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtcacgtgtccgacaccgggac 305  Q
    |||||||| ||||| |||||   ||||||||||||||||||| | ||||| ||||||| |||| |||||| |||||| ||  ||||||||||||||||||    
9027155 cacgacacggacactgacacgccgacaccgctaataatttgagataatcacataattccgtgtaattatatgtgtcg-gtgtcgtgtccgacaccgggac 9027253  T
306 acgtctcgtccaagaagtgt 325  Q
    ||| ||  |||||| |||||    
9027254 acggctaatccaaggagtgt 9027273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 186 - 286
Target Start/End: Original strand, 2117034 - 2117133
Alignment:
186 ctatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgt 285  Q
    ||||||||||||||||||| |||||||| || || |||||   |||||| |||||||||||| ||||||| |||||||| ||  |||||| |||||||||    
2117034 ctatgaagcacggagacggacacgacac-gatacggacactccgacacctctaataatttgaaaaaatcacataattcaatgcaattataagtgtcgtgt 2117132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 206 - 282
Target Start/End: Original strand, 7086772 - 7086848
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||||||||||| | | ||| ||||||||||||| ||||||| |||||| ||||| |||||| ||||||    
7086772 cacgacacagacaccgacacgtcggcactgctaataatttgagaaaatcacataatttagtgtaattatatgtgtcg 7086848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 229 - 333
Target Start/End: Original strand, 7938116 - 7938214
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtcacgtgtccgacaccgggacacgtctcgtccaagaagtgtccg 328  Q
    ||||| ||||||||||||| |||||||||||||| ||||| |||||| ||||||      ||||||||||||| |||||| ||  ||| || ||||||||    
7938116 gacacagctaataatttgaaaaaatcatataatttagtgtaattataagtgtcg------gtgtccgacaccgagacacgcctgatccgaggagtgtccg 7938209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 209 - 282
Target Start/End: Complemental strand, 30866223 - 30866150
Alignment:
209 gacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||||||||||||   |||||||||||||||||| ||||||| |||||||| ||| |||||| ||||||    
30866223 gacactgacaccgacacaccaacaccgctaataatttgagaaaatcacataattcaatgtaattatatgtgtcg 30866150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 230 - 282
Target Start/End: Complemental strand, 7265651 - 7265599
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||||||||| ||||||| |||||||||||| |||||| ||||||    
7265651 acaccgctaataatttgagaaaatcacataattcagtgtaattatatgtgtcg 7265599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 206 - 274
Target Start/End: Complemental strand, 8805654 - 8805586
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattat 274  Q
    |||||||||||||||||||| | | ||| ||||||||||||| ||||||| |||||| ||||| |||||    
8805654 cacgacacagacaccgacacgtcggcactgctaataatttgagaaaatcacataatttagtgtaattat 8805586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 206 - 282
Target Start/End: Original strand, 13851713 - 13851789
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||| ||||| ||||| | ||||||||||||||||||| ||||| |  ||||||||||| |||||| ||||||    
13851713 cacgacacggacactgacacgtcgacaccgctaataatttgagaaaataacgtaattcagtgtaattatatgtgtcg 13851789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 229 - 281
Target Start/End: Complemental strand, 17341723 - 17341671
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    ||||||| ||||||||||||||||||| |||||||||||| |||||| |||||    
17341723 gacaccgttaataatttgataaaatcacataattcagtgtaattataagtgtc 17341671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 229 - 281
Target Start/End: Original strand, 19040352 - 19040404
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    ||||||||||||||||||| ||||||| |||||||||||| |||||| |||||    
19040352 gacaccgctaataatttgagaaaatcacataattcagtgtaattatatgtgtc 19040404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 206 - 277
Target Start/End: Original strand, 7625099 - 7625170
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattatagg 277  Q
    |||||||||||||||||||| | ||||| | ||||||||||| ||||| |||||||| ||| | ||||||||    
7625099 cacgacacagacaccgacacgtcgacacggataataatttgagaaaatgatataatttagtataattatagg 7625170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 229 - 333
Target Start/End: Complemental strand, 7996437 - 7996327
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattata------ggtgtcgtgtcacgtgtccgacaccgggacacgtctcgtccaagaag 322  Q
    ||||| ||||||||||||| |||||||||||||||||||| ||||||      ||||||| | ||||||||  |||| |||||||| ||  |||||| ||    
7996437 gacactgctaataatttgagaaaatcatataattcagtgtaattatatgcgtcggtgtcgcgacacgtgtctaacacggggacacgcctaatccaaggag 7996338  T
323 tgtccgtgctt 333  Q
    | |||||||||    
7996337 tctccgtgctt 7996327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 229 - 333
Target Start/End: Original strand, 8022364 - 8022474
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattata------ggtgtcgtgtcacgtgtccgacaccgggacacgtctcgtccaagaag 322  Q
    ||||| ||||||||||||| |||||||||||||||||||| ||||||      ||||||| | ||||||||  |||| |||||||| ||  |||||| ||    
8022364 gacactgctaataatttgagaaaatcatataattcagtgtaattatatgcgtcggtgtcgcgacacgtgtctaacacggggacacgcctaatccaaggag 8022463  T
323 tgtccgtgctt 333  Q
    | |||||||||    
8022464 tctccgtgctt 8022474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 185 - 280
Target Start/End: Complemental strand, 32511769 - 32511674
Alignment:
185 actatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgt 280  Q
    ||||||||||||||| || | || ||||||||||  | | |  |||||||||||||||||| | ||||||| |||||||||||| |||||| ||||    
32511769 actatgaagcacggataccgacatgacacagacattgcccctctgacaccgctaataatttaagaaaatcacataattcagtgtaattataagtgt 32511674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 188 - 282
Target Start/End: Original strand, 16833267 - 16833361
Alignment:
188 atgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||| || |||| |||||||||||||| |||||   |||||  |||||||||||| ||||||| ||| |||||||| |||| | ||||||    
16833267 atgaagcactgatacggacacgacacagacactgacacgccgacacaactaataatttgaaaaaatcacatacttcagtgtaattacaagtgtcg 16833361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 230 - 275
Target Start/End: Original strand, 1532241 - 1532286
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    |||||||||||||||||||||||| | |||||||||||| ||||||    
1532241 acaccgctaataatttgataaaattacataattcagtgtaattata 1532286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 206 - 275
Target Start/End: Original strand, 3398596 - 3398664
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    |||||||| ||||| |||||   ||||| ||||||||||||| |||||||||||||||||||| ||||||    
3398596 cacgacacggacactgacacgccgacacagctaataatttga-aaaatcatataattcagtgtaattata 3398664  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 206 - 275
Target Start/End: Original strand, 9658856 - 9658925
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    |||||||| ||||| |||||   ||||||||||||||||| | ||||||| |||||||||||| ||||||    
9658856 cacgacacggacactgacacgccgacaccgctaataatttaagaaaatcacataattcagtgtaattata 9658925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 229 - 282
Target Start/End: Complemental strand, 20371169 - 20371116
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||||||||||| ||||||| |||| ||| |||||||||| ||||||    
20371169 gacaccgctaataatttgagaaaatcacataactcaatgtgattatatgtgtcg 20371116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 282
Target Start/End: Complemental strand, 10770776 - 10770680
Alignment:
186 ctatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||||| |||| |||||||  ||||| |||||    ||||  |||||||||||| ||||||| |||||||||||| |||| | ||||||    
10770776 ctatgaagcacggatacggacacgacatggacactgacacgccaacacaactaataatttgaaaaaatcacataattcagtgtaattacaagtgtcg 10770680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 282
Target Start/End: Original strand, 19147799 - 19147895
Alignment:
186 ctatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||||||  | | |||||||||||||  ||||||  ||||||| ||||||||| | |||||||||||  |||| || |||||| ||||||    
19147799 ctatgaagcacggatgcagacacgacacagacagtgacacaaagacaccgttaataatttaagaaaatcatatagatcagagtaattatatgtgtcg 19147895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 234 - 286
Target Start/End: Original strand, 24832593 - 24832645
Alignment:
234 cgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    |||||||||||||| |||||| ||||||| ||||| |||||| ||||||||||    
24832593 cgctaataatttgagaaaatcttataatttagtgtaattatatgtgtcgtgtc 24832645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 235 - 333
Target Start/End: Original strand, 31959165 - 31959264
Alignment:
235 gctaataatttgataaaatcatataattcagtgtgattataggtgtc-gtgtcacgtgtccgacaccgggacacgtctcgtccaagaagtgtccgtgctt 333  Q
    ||||||||||||| ||||||| ||||| |||||| |||| | ||||| | | || |||||||||||||||||||  ||  ||| || |||||||||||||    
31959165 gctaataatttgaaaaaatcacataatgcagtgtaattacaagtgtcggcgacatgtgtccgacaccgggacacacctaatccgaggagtgtccgtgctt 31959264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 228 - 275
Target Start/End: Complemental strand, 32320729 - 32320682
Alignment:
228 tgacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    |||||||| ||||||||||||||||||| |||||||| ||| ||||||    
32320729 tgacaccgttaataatttgataaaatcacataattcaatgtcattata 32320682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 290 - 333
Target Start/End: Complemental strand, 32978887 - 32978844
Alignment:
290 tgtccgacaccgggacacgtctcgtccaagaagtgtccgtgctt 333  Q
    ||||||||||||||||||||||  |||||| |||||||||||||    
32978887 tgtccgacaccgggacacgtctaatccaaggagtgtccgtgctt 32978844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 215 - 286
Target Start/End: Original strand, 34446551 - 34446622
Alignment:
215 gacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    ||||| |||||  |||||| | ||||||||||| ||||| | |||||||||||| || ||||||||||||||    
34446551 gacacagacactctgacacggataataatttgagaaaatgacataattcagtgtaatcataggtgtcgtgtc 34446622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 215 - 265
Target Start/End: Complemental strand, 7723323 - 7723273
Alignment:
215 gacaccgacacattgacaccgctaataatttgataaaatcatataattcag 265  Q
    ||||| ||||| | ||||| ||||||||||||| |||||||||||||||||    
7723323 gacactgacacgtggacactgctaataatttgagaaaatcatataattcag 7723273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 195 - 273
Target Start/End: Original strand, 12696290 - 12696368
Alignment:
195 acggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    ||||| |||| |||||||| ||||| |||||   ||||| ||||||||||||| ||||| | |||||||||||| ||||    
12696290 acggacacggacacgacacggacactgacacgccgacacagctaataatttgaaaaaattacataattcagtgtaatta 12696368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 230 - 280
Target Start/End: Complemental strand, 13689550 - 13689500
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattataggtgt 280  Q
    |||||||||||||||||||||||||||| ||||  |||| |||||| ||||    
13689550 acaccgctaataatttgataaaatcatacaatttcgtgtaattatacgtgt 13689500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 207 - 273
Target Start/End: Complemental strand, 25038152 - 25038086
Alignment:
207 acgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    |||||||||| || ||||| ||||||||| ||||||||||| ||||| | |||||| ||||| ||||    
25038152 acgacacagatactgacacgttgacaccgttaataatttgagaaaattacataatttagtgtaatta 25038086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 230 - 268
Target Start/End: Complemental strand, 34447416 - 34447378
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgt 268  Q
    |||||| |||||||||||||||||||||||||| |||||    
34447416 acaccgttaataatttgataaaatcatataatttagtgt 34447378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 286
Target Start/End: Original strand, 6389751 - 6389800
Alignment:
237 taataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    ||||||||||| ||||| |||||||| ||||| || ||||||||||||||    
6389751 taataatttgagaaaatgatataatttagtgtaatcataggtgtcgtgtc 6389800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 282
Target Start/End: Original strand, 7377979 - 7378032
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||| ||||||| ||||||| |||||||| ||| |||||| ||||||    
7377979 gacaccgctaaaaatttgagaaaatcacataattcaatgtaattatatgtgtcg 7378032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 282
Target Start/End: Original strand, 10842532 - 10842585
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||||||||||| ||||||| |||||| ||||| || ||| ||||||    
10842532 gacaccgctaataatttgaaaaaatcacataatttagtgtaatcatatgtgtcg 10842585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 282
Target Start/End: Complemental strand, 13364764 - 13364711
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||| ||||||||| |||||||||||||||||||| || ||| ||||||    
13364764 gacactgcttataatttgagaaaatcatataattcagtgtaatcatatgtgtcg 13364711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 282
Target Start/End: Original strand, 16766697 - 16766750
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||||||||||||| ||||||| |||||||||||| |||| | ||||||    
16766697 gacacagctaataatttgaaaaaatcacataattcagtgtaattacaagtgtcg 16766750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 286
Target Start/End: Complemental strand, 17168514 - 17168465
Alignment:
237 taataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    ||||||||||| ||||| |||||||| ||||| || ||||||||||||||    
17168514 taataatttgagaaaatgatataatttagtgtaataataggtgtcgtgtc 17168465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 282
Target Start/End: Complemental strand, 21924994 - 21924941
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||||||||||||| || |||| |||||||||||| |||||| ||||||    
21924994 gacactgctaataatttgagaatatcaaataattcagtgtaattatatgtgtcg 21924941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 282
Target Start/End: Original strand, 26562689 - 26562742
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||||| ||||||| ||||||| |||||||||||| |||||| ||||||    
26562689 gacactgctaaaaatttgagaaaatcacataattcagtgtaattatatgtgtcg 26562742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 282
Target Start/End: Original strand, 34595090 - 34595187
Alignment:
186 ctatgaagcacggagac-ggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||||| || || |||||||| ||||  |||||   |||||  |||||||||||| ||||||| |||||||||||| |||| | ||||||    
34595090 ctatgaagcacggacaccggacacgacacggacaatgacacgccgacacaactaataatttgaaaaaatcacataattcagtgtaattacaagtgtcg 34595187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 276 - 308
Target Start/End: Original strand, 7930358 - 7930390
Alignment:
276 ggtgtcgtgtcacgtgtccgacaccgggacacg 308  Q
    ||||||||||||||||||||||||| |||||||    
7930358 ggtgtcgtgtcacgtgtccgacaccaggacacg 7930390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 236 - 276
Target Start/End: Complemental strand, 8389524 - 8389484
Alignment:
236 ctaataatttgataaaatcatataattcagtgtgattatag 276  Q
    |||||||||| | |||||||||||||||||||| |||||||    
8389524 ctaataatttaagaaaatcatataattcagtgtaattatag 8389484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 230 - 274
Target Start/End: Complemental strand, 31579283 - 31579239
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattat 274  Q
    |||||| ||||||||||| ||||||| |||||||||||| |||||    
31579283 acaccgttaataatttgagaaaatcacataattcagtgtaattat 31579239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 49; Significance: 7e-19; HSPs: 37)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 206 - 282
Target Start/End: Complemental strand, 21141064 - 21140988
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||| ||| ||||||| | |||||| |||||||||| | ||||||||||||||||||||||||||||||||||    
21141064 cacgacacggacgccgacacgtcgacaccactaataatttaagaaaatcatataattcagtgtgattataggtgtcg 21140988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 187 - 282
Target Start/End: Original strand, 15902780 - 15902875
Alignment:
187 tatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||| | |||| |||||||||||||| ||||    ||||||  ||||||||||||||||||| |||||| ||||| |||||| ||||||    
15902780 tatgaagcacgaatacggacacgacacagacactgacatgccgacaccaataataatttgataaaatcacataatttagtgtaattatatgtgtcg 15902875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 206 - 275
Target Start/End: Original strand, 5235963 - 5236032
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    |||||||||||||| ||||| | ||||||||||||||||| | ||||| |||||||| ||||| ||||||    
5235963 cacgacacagacactgacacgtcgacaccgctaataatttaagaaaattatataatttagtgtaattata 5236032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 209 - 282
Target Start/End: Original strand, 20549771 - 20549844
Alignment:
209 gacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||| |||| ||||||  ||||||||||||||||||| |||||||  ||||||||||| |||||| ||||||    
20549771 gacacatacactgacacaccgacaccgctaataatttgagaaaatcacgtaattcagtgtaattatatgtgtcg 20549844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 206 - 266
Target Start/End: Original strand, 26733281 - 26733341
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagt 266  Q
    |||||||| ||||| ||||| | ||||||||||||||||||| ||||||| ||||||||||    
26733281 cacgacacggacactgacacgtcgacaccgctaataatttgacaaaatcacataattcagt 26733341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 218 - 281
Target Start/End: Original strand, 17851420 - 17851483
Alignment:
218 accgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    |||||||||| || |||||||||||||| | ||||||| |||||||||||| |||||| |||||    
17851420 accgacacatcgataccgctaataattttagaaaatcacataattcagtgtaattatatgtgtc 17851483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 215 - 281
Target Start/End: Complemental strand, 42720963 - 42720897
Alignment:
215 gacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    ||||| ||||| ||||||||||||||||||||| ||||||| |||||| | ||| |||||| |||||    
42720963 gacactgacacgttgacaccgctaataatttgaaaaaatcacataattaaatgtaattatatgtgtc 42720897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 209 - 282
Target Start/End: Complemental strand, 3520421 - 3520348
Alignment:
209 gacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||  |||||  |||||||| |||| |||||| |||||||||||||||| ||| |||||| ||||||    
3520421 gacacagacattgacacgctgacaccgataatcatttgagaaaatcatataattcaatgtaattatatgtgtcg 3520348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 237 - 286
Target Start/End: Original strand, 23751908 - 23751957
Alignment:
237 taataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    ||||||||||||||||| |||||||| ||||| || ||||||||||||||    
23751908 taataatttgataaaatgatataatttagtgtaatcataggtgtcgtgtc 23751957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 229 - 274
Target Start/End: Complemental strand, 29787428 - 29787383
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattat 274  Q
    ||||||||||||||||||| ||||||| |||||||||||| |||||    
29787428 gacaccgctaataatttgagaaaatcacataattcagtgtaattat 29787383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 229 - 281
Target Start/End: Original strand, 5548676 - 5548728
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    ||||||||| ||||||||| ||||||| |||||||||||| |||||| |||||    
5548676 gacaccgctgataatttgagaaaatcaaataattcagtgtaattatatgtgtc 5548728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 282
Target Start/End: Original strand, 19206027 - 19206103
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||| |||||| ||||   ||||||||||||||||||| ||||||| |||||||| | | |||||| ||||||    
19206027 cacgacacggacaccaacacgccgacaccgctaataatttgagaaaatcacataattcattataattatatgtgtcg 19206103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 229 - 281
Target Start/End: Original strand, 32308120 - 32308172
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    ||||||||||||||||||| ||||||| |||||||||||| ||| || |||||    
32308120 gacaccgctaataatttgagaaaatcacataattcagtgtaattgtatgtgtc 32308172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 282
Target Start/End: Original strand, 49107798 - 49107873
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||| ||| | ||||||  ||||||||||||||||||| |||| || |||||| |||||||||||| ||||||    
49107798 cacgacacggactctgacacaccgacaccgctaataatttgagaaaa-cacataattgagtgtgattatatgtgtcg 49107873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 286 - 333
Target Start/End: Original strand, 598275 - 598322
Alignment:
286 cacgtgtccgacaccgggacacgtctcgtccaagaagtgtccgtgctt 333  Q
    ||||||||||||||||||||||| ||  ||| ||||||||||||||||    
598275 cacgtgtccgacaccgggacacgcctaatccgagaagtgtccgtgctt 598322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 286 - 333
Target Start/End: Original strand, 9778572 - 9778619
Alignment:
286 cacgtgtccgacaccgggacacgtctcgtccaagaagtgtccgtgctt 333  Q
    ||||||||||||||||||||||| ||  |||||| |||||||||||||    
9778572 cacgtgtccgacaccgggacacgcctaatccaaggagtgtccgtgctt 9778619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 186 - 306
Target Start/End: Original strand, 12289070 - 12289189
Alignment:
186 ctatgaagcacggagacggccacgacacagacaccgacacattgac-accgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtg 284  Q
    |||||||||||||| || | ||| |||| |||||||||||   | | || ||||||||||||| ||||||| |||||||||||  |||||  ||||||||    
12289070 ctatgaagcacggatacagacacaacacggacaccgacacgccggccactgctaataatttgagaaaatcacataattcagtggaattat--gtgtcgtg 12289167  T
285 tcacgtgtccgacaccgggaca 306  Q
    ||| |||| |||| | ||||||    
12289168 tcatgtgttcgactctgggaca 12289189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 286
Target Start/End: Original strand, 5938480 - 5938529
Alignment:
237 taataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    ||||||||||||||||| | |||||||||| | ||||||||||| |||||    
5938480 taataatttgataaaataacataattcagtataattataggtgttgtgtc 5938529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 220 - 273
Target Start/End: Original strand, 11831423 - 11831476
Alignment:
220 cgacacattgacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    |||||||| |||||  |||||||||||| |||||||||||||| ||||| ||||    
11831423 cgacacatcgacacaactaataatttgaaaaaatcatataatttagtgtaatta 11831476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 274
Target Start/End: Complemental strand, 11890970 - 11890933
Alignment:
237 taataatttgataaaatcatataattcagtgtgattat 274  Q
    ||||||||||| |||||||||||||||||||| |||||    
11890970 taataatttgaaaaaatcatataattcagtgtaattat 11890933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 236 - 273
Target Start/End: Original strand, 13300417 - 13300454
Alignment:
236 ctaataatttgataaaatcatataattcagtgtgatta 273  Q
    |||||||||||| |||||||||||||||||||| ||||    
13300417 ctaataatttgaaaaaatcatataattcagtgtaatta 13300454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 225 - 274
Target Start/End: Original strand, 14729697 - 14729746
Alignment:
225 cattgacaccgctaataatttgataaaatcatataattcagtgtgattat 274  Q
    |||||| |||||||||||||||| |||||||  ||||||||||| |||||    
14729697 cattgaaaccgctaataatttgagaaaatcacgtaattcagtgtaattat 14729746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 308
Target Start/End: Complemental strand, 18215239 - 18215167
Alignment:
235 gctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtcacgtgtccgacaccgggacacg 308  Q
    ||||||||||||| ||||||| ||||| ||||||  ||| | |||||| ||  |||||||||||||||||||||    
18215239 gctaataatttgaaaaaatcacataatgcagtgtagttacaagtgtcg-gtgtcgtgtccgacaccgggacacg 18215167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 282
Target Start/End: Original strand, 19992001 - 19992054
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||||||||||||| ||||||| ||| |||||||| |||||| ||||||    
19992001 gacacagctaataatttgagaaaatcacatatttcagtgtaattataagtgtcg 19992054  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 282
Target Start/End: Original strand, 24339642 - 24339695
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||||||||||||| ||||||| |||||||||||| |||| | ||||||    
24339642 gacacagctaataatttgaaaaaatcacataattcagtgtaattacaagtgtcg 24339695  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 286
Target Start/End: Complemental strand, 29812715 - 29812666
Alignment:
237 taataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    ||||||||||| ||||| |||||||| ||||| || ||||||||||||||    
29812715 taataatttgagaaaatgatataatttagtgtaatcataggtgtcgtgtc 29812666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 234 - 274
Target Start/End: Original strand, 2424619 - 2424659
Alignment:
234 cgctaataatttgataaaatcatataattcagtgtgattat 274  Q
    |||||||||||||| ||||||| |||||||||||| |||||    
2424619 cgctaataatttgagaaaatcacataattcagtgtaattat 2424659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 285
Target Start/End: Complemental strand, 4017897 - 4017797
Alignment:
186 ctatgaagcacggagac-ggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtg 284  Q
    ||||||||||| || || || |||||||| |||||||||||   ||||| | ||||||||||| ||||  |||||||| ||||| || ||| ||||||||    
4017897 ctatgaagcacagacactggacacgacacggacaccgacacgccgacacggataataatttgagaaaacgatataatttagtgtaatcataagtgtcgtg 4017798  T
285 t 285  Q
    |    
4017797 t 4017797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 237 - 285
Target Start/End: Complemental strand, 8239101 - 8239053
Alignment:
237 taataatttgataaaatcatataattcagtgtgattataggtgtcgtgt 285  Q
    ||||||||| | |||||| ||||||||||||| |||||| |||||||||    
8239101 taataatttaagaaaatcttataattcagtgtaattatatgtgtcgtgt 8239053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 190 - 265
Target Start/End: Complemental strand, 11722197 - 11722121
Alignment:
190 gaagcacggagac-ggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcag 265  Q
    |||||||||| || || |||||||| ||||| |||||   ||||||||||| ||||||| ||||||| |||||||||    
11722197 gaagcacggataccggacacgacacggacactgacacgccgacaccgctaacaatttgagaaaatcacataattcag 11722121  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 206 - 282
Target Start/End: Complemental strand, 22602792 - 22602716
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||| ||| |||||   |||||||  ||| |||||| ||||||| |||||||||||| |||||| ||||||    
22602792 cacgacacaggcactgacacgccgacaccgtaaattatttgagaaaatcacataattcagtgtaattatatgtgtcg 22602716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 281
Target Start/End: Original strand, 22868042 - 22868094
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    |||||| |||||||| ||| ||||||| |||||||||||| |||||| |||||    
22868042 gacaccactaataatatgagaaaatcacataattcagtgtaattatatgtgtc 22868094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 273
Target Start/End: Original strand, 23191896 - 23191940
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    ||||||||||||||||||| ||||||| ||| |||||||| ||||    
23191896 gacaccgctaataatttgagaaaatcacatatttcagtgtaatta 23191940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 273
Target Start/End: Original strand, 25481902 - 25481946
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    ||||| ||||||||||||| ||||||| |||||||||||| ||||    
25481902 gacacagctaataatttgaaaaaatcacataattcagtgtaatta 25481946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 206 - 282
Target Start/End: Complemental strand, 26329464 - 26329388
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||||| |||||   |||| || ||||||||||| |||| || | |||||||||| |||||| ||||||    
26329464 cacgacacagacactgacacgccgacatcgttaataatttgagaaaaacacacaattcagtgtaattatatgtgtcg 26329388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 206 - 282
Target Start/End: Original strand, 27945018 - 27945094
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||| ||||| |||||   |||||| |||||||||||| ||||| | |||||||||||| |||| | ||||||    
27945018 cacgacacggacactgacacgccgacaccactaataatttgagaaaattacataattcagtgtaattacaagtgtcg 27945094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 187 - 286
Target Start/End: Original strand, 43249950 - 43250050
Alignment:
187 tatgaagcacggagac-ggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgt 285  Q
    ||||||||||||| || || || ||||| ||||| |||||   ||||| | ||||||||||| ||||| | ||||| |||||| |||||| |||||||||    
43249950 tatgaagcacggacaccggacaagacacggacactgacacgccgacacggataataatttgagaaaatgacataatacagtgtaattataagtgtcgtgt 43250049  T
286 c 286  Q
    |    
43250050 c 43250050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0020 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: scaffold0020
Description:

Target: scaffold0020; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 207 - 308
Target Start/End: Complemental strand, 135393 - 135293
Alignment:
207 acgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtcacgtgtccgacaccgggaca 306  Q
    |||||||||||||| |||||  ||||| ||||||||||||| ||||||| ||||||| |||| |||||| |||||| ||  ||||||||||||| |||||    
135393 acgacacagacaccaacacaccgacactgctaataatttgagaaaatcacataattctgtgtaattatatgtgtcg-gtgtcgtgtccgacaccaggaca 135295  T
307 cg 308  Q
    ||    
135294 cg 135293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 46; Significance: 4e-17; HSPs: 36)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 215 - 276
Target Start/End: Complemental strand, 23870632 - 23870571
Alignment:
215 gacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattatag 276  Q
    ||||| ||||| | ||||||||||||||||||| ||||||||||||||||||||||||||||    
23870632 gacacggacacgtcgacaccgctaataatttgaaaaaatcatataattcagtgtgattatag 23870571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 179 - 282
Target Start/End: Original strand, 26508060 - 26508163
Alignment:
179 ttacacactatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggt 278  Q
    |||||| |||||||| ||||| |||| ||||| ||||| || |||||  |||||| ||||||||||||| ||||||| |||||||||||| |||| | ||    
26508060 ttacacgctatgaagaacggatacggacacgatacagatactgacacgctgacacagctaataatttgaaaaaatcacataattcagtgtaattacaagt 26508159  T
279 gtcg 282  Q
    ||||    
26508160 gtcg 26508163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 229 - 282
Target Start/End: Original strand, 8383257 - 8383310
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||||||||||| |||||||||||||||||||| |||||| ||||||    
8383257 gacaccgctaataatttgagaaaatcatataattcagtgtaattataagtgtcg 8383310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 209 - 286
Target Start/End: Complemental strand, 34307859 - 34307782
Alignment:
209 gacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    |||||||||||  ||||  |||||||||||||||||||| ||||||| ||| |||||||| |||||| ||||||||||    
34307859 gacacagacacgaacacgctgacaccgctaataatttgagaaaatcacatatttcagtgtaattataagtgtcgtgtc 34307782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 230 - 282
Target Start/End: Complemental strand, 17005677 - 17005625
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||||||||||||||||||||||||||||||||| |||||| ||||||    
17005677 acaccactaataatttgataaaatcatataattcagtgtaattataagtgtcg 17005625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 229 - 307
Target Start/End: Complemental strand, 13620823 - 13620744
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc-gtgtcacgtgtccgacaccgggacac 307  Q
    |||||||||| |||||||| ||||||| || ||||||||   ||||| ||||| ||||||||||||||||||||||||||    
13620823 gacaccgctagtaatttgagaaaatcacatgattcagtgcagttatatgtgtctgtgtcacgtgtccgacaccgggacac 13620744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 229 - 282
Target Start/End: Original strand, 7928450 - 7928503
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||||||||||| ||||||| |||||||||||| |||||| ||||||    
7928450 gacaccgctaataatttgaaaaaatcacataattcagtgtaattatatgtgtcg 7928503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 201 - 282
Target Start/End: Original strand, 11658787 - 11658868
Alignment:
201 acggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||| |||||||||||||| ||||||   ||| || ||||||||||| ||||||  ||||||||||||||||||| ||||||    
11658787 acggacacgacacagacactgacacaccaacatcgttaataatttgagaaaatcgcataattcagtgtgattatatgtgtcg 11658868  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 230 - 282
Target Start/End: Complemental strand, 8039893 - 8039841
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||||||||| ||||| |||||||||||||| |||||| ||||||    
8039893 acaccgctaataatttgagaaaattatataattcagtgtaattatatgtgtcg 8039841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 215 - 263
Target Start/End: Original strand, 15544679 - 15544727
Alignment:
215 gacaccgacacattgacaccgctaataatttgataaaatcatataattc 263  Q
    ||||| ||||| ||||||||||||||||||||||||||||| |||||||    
15544679 gacactgacacgttgacaccgctaataatttgataaaatcacataattc 15544727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 215 - 275
Target Start/End: Complemental strand, 29112353 - 29112293
Alignment:
215 gacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    ||||| ||||| |||||||| ||||| |||||| |||||||||||||||||||| ||||||    
29112353 gacactgacacgttgacaccactaattatttgagaaaatcatataattcagtgtaattata 29112293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 186 - 273
Target Start/End: Complemental strand, 26492307 - 26492220
Alignment:
186 ctatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    |||||||||||| | |||| |||||||| ||||| |||||   ||||  ||||||||||||| ||||||||| |||||||||| ||||    
26492307 ctatgaagcacgaatacggacacgacacggacactgacacgccgacagagctaataatttgaaaaaatcatacaattcagtgtaatta 26492220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 236 - 282
Target Start/End: Original strand, 29508451 - 29508497
Alignment:
236 ctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||| |||||||||||||||||||| |||||| ||||||    
29508451 ctaataatttgaaaaaatcatataattcagtgtaattatatgtgtcg 29508497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 291 - 333
Target Start/End: Original strand, 29508522 - 29508564
Alignment:
291 gtccgacaccgggacacgtctcgtccaagaagtgtccgtgctt 333  Q
    |||||||||||||||||||||  ||||||||||||||||||||    
29508522 gtccgacaccgggacacgtctaatccaagaagtgtccgtgctt 29508564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 282
Target Start/End: Original strand, 11665921 - 11665997
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||| ||||  |||||  |||| |||||||||||||||||||||| | |||| ||||| |||||| ||||||    
11665921 cacgacacacacactaacacaccgacaacgctaataatttgataaaatcacacaatttagtgtaattatatgtgtcg 11665997  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 201 - 301
Target Start/End: Complemental strand, 14223940 - 14223841
Alignment:
201 acggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtcacgtgtccgacacc 300  Q
    |||| ||||||||||||||||||||   ||||| | ||||||||||| ||||  |||||||| |||||  | ||| ||||||||||  ||||||||||||    
14223940 acggacacgacacagacaccgacacgccgacacagataataatttgagaaaacgatataatttagtgtattcataagtgtcgtgtc-ggtgtccgacacc 14223842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 230 - 281
Target Start/End: Original strand, 1550141 - 1550192
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    |||||||||||||||||| ||||||| |  ||||||||| ||||||||||||    
1550141 acaccgctaataatttgaaaaaatcacactattcagtgtaattataggtgtc 1550192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 237 - 300
Target Start/End: Original strand, 25892468 - 25892530
Alignment:
237 taataatttgataaaatcatataattcagtgtgattataggtgtcgtgtcacgtgtccgacacc 300  Q
    ||||||||| | ||||| |||||||||||||| || ||||||||||||||| ||||| ||||||    
25892468 taataatttaagaaaatgatataattcagtgtaatcataggtgtcgtgtca-gtgtcggacacc 25892530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 229 - 275
Target Start/End: Complemental strand, 10690321 - 10690275
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    ||||||||||||||| ||| ||||||| |||||||||||| ||||||    
10690321 gacaccgctaataatctgagaaaatcacataattcagtgtaattata 10690275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 216 - 266
Target Start/End: Complemental strand, 21257058 - 21257008
Alignment:
216 acaccgacacattgacaccgctaataatttgataaaatcatataattcagt 266  Q
    ||||||||||  |||||| ||||||||||||| ||||||| ||||||||||    
21257058 acaccgacacgatgacacagctaataatttgaaaaaatcacataattcagt 21257008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 237 - 287
Target Start/End: Complemental strand, 25652082 - 25652032
Alignment:
237 taataatttgataaaatcatataattcagtgtgattataggtgtcgtgtca 287  Q
    ||||||||||| ||||| ||||||||||||||  |||||||||| ||||||    
25652082 taataatttgagaaaatgatataattcagtgtagttataggtgttgtgtca 25652032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 186 - 282
Target Start/End: Complemental strand, 40993432 - 40993341
Alignment:
186 ctatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaa-tcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||||| |||| |||||||| ||||||      | ||||||||||||||||| | |||| ||| |||||||||||| |||||| ||||||    
40993432 ctatgaagcacggatacggacacgacacggacacc------tcgacaccgctaataatttaaaaaaaatcacataattcagtgtaattatatgtgtcg 40993341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 215 - 281
Target Start/End: Complemental strand, 49505227 - 49505161
Alignment:
215 gacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    |||||||||||   || |||||||||||||||| ||||||| |||||| ||||| |||||| |||||    
49505227 gacaccgacacgcagagaccgctaataatttgagaaaatcacataatttagtgtaattatatgtgtc 49505161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 286
Target Start/End: Original strand, 15864841 - 15864890
Alignment:
237 taataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    ||||||||||| ||||| |||||||| ||||| || ||||||||||||||    
15864841 taataatttgaaaaaatgatataatttagtgtaatcataggtgtcgtgtc 15864890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 331
Target Start/End: Complemental strand, 16000002 - 15999957
Alignment:
286 cacgtgtccgacaccgggacacgtctcgtccaagaagtgtccgtgc 331  Q
    ||||||||||||||||||||||| ||  |||||| |||||||||||    
16000002 cacgtgtccgacaccgggacacgcctaatccaaggagtgtccgtgc 15999957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 219 - 280
Target Start/End: Complemental strand, 16192819 - 16192758
Alignment:
219 ccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgt 280  Q
    ||||||||  ||||||| ||||||||||| ||||| | |||||||||||| |||||| ||||    
16192819 ccgacacaccgacaccgttaataatttgagaaaataacataattcagtgtaattatatgtgt 16192758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 209 - 282
Target Start/End: Complemental strand, 22774149 - 22774076
Alignment:
209 gacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||| ||||| | |||||| ||||||||| || ||| ||| ||| |||||||| |||||| ||||||    
22774149 gacacagacacagacacgtcgacaccactaataattagacaaagtcacatatttcagtgtaattataagtgtcg 22774076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 235 - 280
Target Start/End: Complemental strand, 25948940 - 25948895
Alignment:
235 gctaataatttgataaaatcatataattcagtgtgattataggtgt 280  Q
    ||||||||||||| ||||||| |||||||||||| |||||| ||||    
25948940 gctaataatttgaaaaaatcacataattcagtgtaattataagtgt 25948895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 286
Target Start/End: Complemental strand, 35994796 - 35994740
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    ||||| ||||||||||||| ||||||| |||||||||||| |||| | ||||||||||    
35994796 gacacagctaataatttga-aaaatcacataattcagtgtaattacaagtgtcgtgtc 35994740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 273
Target Start/End: Complemental strand, 4987350 - 4987306
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    ||||| ||||||||||||| ||||||| |||||||||||| ||||    
4987350 gacacagctaataatttgaaaaaatcacataattcagtgtaatta 4987306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 230 - 333
Target Start/End: Original strand, 11610522 - 11610623
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtcacgtgtccgacaccgggacacgtctcgtccaagaagtgtccgt 329  Q
    |||||||||||||||| | ||||||| ||||||||||||  ||| | |||||  ||  ||||||||||| ||||||||| ||  ||  || |||||||||    
11610522 acaccgctaataatttaaaaaaatcacataattcagtgtagttacaagtgtcaagt--cgtgtccgacatcgggacacgcctaatctgaggagtgtccgt 11610619  T
330 gctt 333  Q
    ||||    
11610620 gctt 11610623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 237 - 273
Target Start/End: Complemental strand, 15796345 - 15796309
Alignment:
237 taataatttgataaaatcatataattcagtgtgatta 273  Q
    ||||||||||| |||||||||||||||||||| ||||    
15796345 taataatttgaaaaaatcatataattcagtgtaatta 15796309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 206 - 286
Target Start/End: Complemental strand, 24205123 - 24205043
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    |||||||| ||||| |||||   ||||| | ||||||||||| ||||| | ||||| |||||| |||||| ||||||||||    
24205123 cacgacacggacactgacacgccgacacggataataatttgagaaaatgacataatacagtgtaattataagtgtcgtgtc 24205043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 206 - 274
Target Start/End: Original strand, 25064886 - 25064954
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattat 274  Q
    |||||||||||||  |||||   |||||||||||| |||||| ||||||| |||||| ||||| |||||    
25064886 cacgacacagacattgacacgccgacaccgctaatgatttgaaaaaatcacataatttagtgtaattat 25064954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 281
Target Start/End: Complemental strand, 32804599 - 32804547
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    ||||||| ||||||||||| ||||||| |||||| ||||| |||||| |||||    
32804599 gacaccgttaataatttgagaaaatcacataatttagtgtaattatatgtgtc 32804547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 228 - 268
Target Start/End: Complemental strand, 51206413 - 51206373
Alignment:
228 tgacaccgctaataatttgataaaatcatataattcagtgt 268  Q
    |||||| ||||||||||||| ||||||| ||||||||||||    
51206413 tgacacagctaataatttgaaaaaatcacataattcagtgt 51206373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 29)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 207 - 281
Target Start/End: Complemental strand, 24362283 - 24362209
Alignment:
207 acgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    |||||||||||||||||||   ||||||||||||||||||| | ||||| |||||||||||| |||||| |||||    
24362283 acgacacagacaccgacacgccgacaccgctaataatttgagagaatcacataattcagtgtaattatatgtgtc 24362209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 215 - 282
Target Start/End: Original strand, 34897071 - 34897138
Alignment:
215 gacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||||| | ||||||||||||||||||| ||||||| |||||||||||| |||||| ||||||    
34897071 gacacagacacgtcgacaccgctaataatttgagaaaatcacataattcagtgtaattatatgtgtcg 34897138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 206 - 282
Target Start/End: Complemental strand, 12570590 - 12570514
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| |||||||||||||| ||||||| ||||||||||| | |||| || |||||| ||||| |||||| ||||||    
12570590 cacgatacagacaccgacacgttgacactgctaataatttaagaaaaacacataattaagtgtaattatatgtgtcg 12570514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 206 - 286
Target Start/End: Original strand, 39820406 - 39820486
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    ||||||||||||||||||||  |||| |   ||||||||||| ||||| |||||||| ||||| || ||||||||||||||    
39820406 cacgacacagacaccgacacgctgacccgtataataatttgagaaaatgatataatttagtgtaatcataggtgtcgtgtc 39820486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 195 - 282
Target Start/End: Original strand, 24669399 - 24669486
Alignment:
195 acggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| |||| |||||||||||||| |||||  |||||||| |||||||||||  |||| | |||||||||||| |||| | ||||||    
24669399 acggacacggacacgacacagacactgacacgctgacaccgttaataatttgaggaaattacataattcagtgtaattacaagtgtcg 24669486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 235 - 281
Target Start/End: Original strand, 3025557 - 3025603
Alignment:
235 gctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    ||||||||||||| ||||||| |||||||||||| ||||||||||||    
3025557 gctaataatttgagaaaatcacataattcagtgtaattataggtgtc 3025603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 215 - 285
Target Start/End: Original strand, 3658133 - 3658203
Alignment:
215 gacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgt 285  Q
    ||||||||||||| ||||| | ||||||||||| ||||| || || |||||||| || |||||||||||||    
3658133 gacaccgacacatcgacacggataataatttgagaaaataatgtagttcagtgtaatcataggtgtcgtgt 3658203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 237 - 282
Target Start/End: Complemental strand, 11927137 - 11927092
Alignment:
237 taataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||||||||||| |||||||||||| |||||| ||||||    
11927137 taataatttgataaaatcacataattcagtgtaattatatgtgtcg 11927092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 229 - 282
Target Start/End: Complemental strand, 12606888 - 12606835
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||||||||||||| |||||||||||||||| ||| |||||| ||||||    
12606888 gacactgctaataatttgagaaaatcatataattcaatgtaattatatgtgtcg 12606835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 268
Target Start/End: Complemental strand, 18067994 - 18067954
Alignment:
228 tgacaccgctaataatttgataaaatcatataattcagtgt 268  Q
    |||||||||||||||||||| ||||||| ||||||||||||    
18067994 tgacaccgctaataatttgagaaaatcacataattcagtgt 18067954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 215 - 275
Target Start/End: Complemental strand, 39954352 - 39954292
Alignment:
215 gacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    |||||||||||   ||||||||||||||||||| ||||||| |||||| ||||| ||||||    
39954352 gacaccgacacgccgacaccgctaataatttgagaaaatcacataatttagtgtaattata 39954292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 206 - 273
Target Start/End: Complemental strand, 4673507 - 4673440
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    |||||||||||||| |||||   ||||| | ||||||||||| ||||||||| |||||||||| ||||    
4673507 cacgacacagacactgacacgccgacacagataataatttgaaaaaatcataaaattcagtgtaatta 4673440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 206 - 273
Target Start/End: Original strand, 8343293 - 8343360
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    |||||||| ||||||||||||  ||||  ||||||||||||| ||||||| |||||| ||||| ||||    
8343293 cacgacactgacaccgacacaccgacatagctaataatttgaaaaaatcacataatttagtgtaatta 8343360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 229 - 275
Target Start/End: Original strand, 4611534 - 4611580
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    ||||||||||||||||||| ||||| | |||||||||||| ||||||    
4611534 gacaccgctaataatttgagaaaataacataattcagtgtaattata 4611580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 212 - 282
Target Start/End: Complemental strand, 20679471 - 20679401
Alignment:
212 acagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||| ||||  | |||||| |||||||||||| ||||||| ||| |||||||| |||||| ||||||    
20679471 acagacactgacatgtcgacacccctaataatttgagaaaatcacatagttcagtgtaattataagtgtcg 20679401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 228 - 282
Target Start/End: Original strand, 25566840 - 25566894
Alignment:
228 tgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||| ||||||||||||| ||||||| |||||||||||| |||| | ||||||    
25566840 tgacacagctaataatttgaaaaaatcacataattcagtgtaattacaagtgtcg 25566894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 206 - 280
Target Start/End: Original strand, 36934647 - 36934721
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgt 280  Q
    |||||||| |||||  |||| | |||||||||||||||| || ||||||| |||||||| ||| |||||| ||||    
36934647 cacgacacggacactaacacgtcgacaccgctaataattcgaaaaaatcacataattcattgtaattatatgtgt 36934721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 282
Target Start/End: Original strand, 11944673 - 11944718
Alignment:
237 taataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||||||||||| |||| ||||||| |||||| ||||||    
11944673 taataatttgataaaatcacataactcagtgtaattatatgtgtcg 11944718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 275
Target Start/End: Complemental strand, 12570808 - 12570747
Alignment:
214 agacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    |||||||||||| ||||||||||||||||||| | |||| |  |||||| ||||| ||||||    
12570808 agacaccgacacgttgacaccgctaataatttaagaaaaacgcataattaagtgtaattata 12570747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 282
Target Start/End: Complemental strand, 13844655 - 13844602
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||||||||||||| ||||||| |||||| ||||| |||||| ||||||    
13844655 gacactgctaataatttgagaaaatcacataattgagtgtaattatatgtgtcg 13844602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 282
Target Start/End: Complemental strand, 31236636 - 31236583
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||||||||||||| ||||||| |||||||| ||| |||||| ||||||    
31236636 gacactgctaataatttgagaaaatcacataattcaatgtaattatatgtgtcg 31236583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 206 - 282
Target Start/End: Complemental strand, 2572138 - 2572062
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||| || |||||||| | |||||  |||||||||||| ||||||| |||||| ||||| |||| | ||||||    
2572138 cacgacacggataccgacacgtcgacacacctaataatttgaaaaaatcacataatttagtgtaattacaagtgtcg 2572062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 228 - 264
Target Start/End: Complemental strand, 18069191 - 18069155
Alignment:
228 tgacaccgctaataatttgataaaatcatataattca 264  Q
    |||||||||||||||||||| ||||||| ||||||||    
18069191 tgacaccgctaataatttgagaaaatcaaataattca 18069155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 289 - 333
Target Start/End: Original strand, 22652057 - 22652101
Alignment:
289 gtgtccgacaccgggacacgtctcgtccaagaagtgtccgtgctt 333  Q
    |||||||||||||||||||||||  ||| || |||||||||||||    
22652057 gtgtccgacaccgggacacgtctaatccgaggagtgtccgtgctt 22652101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 206 - 302
Target Start/End: Original strand, 22850321 - 22850416
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtcacgtgtccgacaccgg 302  Q
    ||||| ||||||||||||||| | |||||| | ||||||||| ||||  | |||||| | ||| ||||||||| || |||||  |||||||||||||    
22850321 cacgaaacagacaccgacacactaacaccgatgataatttgagaaaaagacataattaaatgtaattataggtttcatgtca-atgtccgacaccgg 22850416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 281
Target Start/End: Original strand, 27101515 - 27101566
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    ||||||||||||||||||| ||||||| |||||| ||||  ||||||||||||    
27101515 gacaccgctaataatttgaaaaaatcacataatttagtg-aattataggtgtc 27101566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 187 - 275
Target Start/End: Original strand, 29775994 - 29776082
Alignment:
187 tatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    ||||||||||| | |||| |||||||| ||||  ||||  | ||||| ||||||||||||| |||||||  ||||||||| | ||||||    
29775994 tatgaagcacgaatacggtcacgacacggacattgacaagtcgacactgctaataatttgagaaaatcacgtaattcagtataattata 29776082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 211 - 275
Target Start/End: Complemental strand, 34201123 - 34201059
Alignment:
211 cacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    |||||| ||||||||||||||||   ||||||||||| ||||| | |||||||| ||| ||||||    
34201123 cacagataccgacacattgacactaataataatttgagaaaatgacataattcaatgtaattata 34201059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 234 - 282
Target Start/End: Original strand, 34222952 - 34223000
Alignment:
234 cgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||| ||||||||| |||||| ||||| |||||| ||||||    
34222952 cgctaataatttaataaaatcacataattaagtgtaattatatgtgtcg 34223000  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 33)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 232 - 286
Target Start/End: Complemental strand, 5468034 - 5467980
Alignment:
232 accgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    |||| ||||||||||||||||||| |||||||||||| |||||||||||||||||    
5468034 accgataataatttgataaaatcacataattcagtgtaattataggtgtcgtgtc 5467980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 206 - 287
Target Start/End: Original strand, 25863181 - 25863262
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtca 287  Q
    ||||||||||||| |||||| | ||||    ||||||||||| ||||| |||||||||||||| |||||| |||||||||||    
25863181 cacgacacagacatcgacacgtcgacatgtataataatttgagaaaatgatataattcagtgtaattataagtgtcgtgtca 25863262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 229 - 282
Target Start/End: Complemental strand, 28588733 - 28588680
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||| ||||||||||| ||||||| |||||||||||| |||||||||||||    
28588733 gacaccggtaataatttgagaaaatcacataattcagtgtaattataggtgtcg 28588680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 212 - 275
Target Start/End: Original strand, 12927637 - 12927700
Alignment:
212 acagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    |||||||| ||||||  |||| |||||||||||||| |||||||||||||| ||||| ||||||    
12927637 acagacacggacacaccgacatcgctaataatttgagaaaatcatataatttagtgtaattata 12927700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 186 - 333
Target Start/End: Original strand, 2436878 - 2437025
Alignment:
186 ctatgaagcacggagacggccac--gacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgt 283  Q
    |||||||||||||| |||| |||  ||||| ||||| |||||   ||||||||||||||||||  ||||||| |||||||  |||||||||| ||||||     
2436878 ctatgaagcacggatacggacaccggacac-gacactgacacgccgacaccgctaataatttgcaaaaatcacataattcgttgtgattatatgtgtcg- 2436975  T
284 gtcacgtgtccgacaccgggacacgtctcgtccaagaagtgtccgtgctt 333  Q
    ||  |||||||||||||  |||||| ||  ||| || ||||| |||||||    
2436976 gtgtcgtgtccgacaccaagacacgcctaatccgaggagtgttcgtgctt 2437025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 229 - 282
Target Start/End: Original strand, 3966503 - 3966556
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||||||||||| ||||||| | |||||||||| |||||| ||||||    
3966503 gacaccgctaataatttgagaaaatcacacaattcagtgtaattatatgtgtcg 3966556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 222 - 275
Target Start/End: Original strand, 10022625 - 10022678
Alignment:
222 acacattgacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    |||||| |||| || | |||||||||||||||||||||||||||||| ||||||    
10022625 acacatcgacatcgttgataatttgataaaatcatataattcagtgtaattata 10022678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 206 - 287
Target Start/End: Complemental strand, 14574131 - 14574051
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtca 287  Q
    ||||||||| ||||||||||   |||||   |||||||||||| |||| |||||||||||||| ||||||||| ||||||||    
14574131 cacgacacaaacaccgacacgccgacacgagtaataatttgatgaaatgatataattcagtgtaattataggt-tcgtgtca 14574051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 229 - 282
Target Start/End: Original strand, 23220983 - 23221036
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||||||||||||||||||| |||||| ||||| || ||| ||||||    
23220983 gacaccgctaataatttgataaaatcacataatttagtgttatcatatgtgtcg 23221036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 228 - 280
Target Start/End: Complemental strand, 6471949 - 6471897
Alignment:
228 tgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgt 280  Q
    |||||| ||||||||||||| ||||||| |||||||||||| |||||| ||||    
6471949 tgacacggctaataatttgagaaaatcacataattcagtgtaattatatgtgt 6471897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 209 - 281
Target Start/End: Original strand, 27144443 - 27144515
Alignment:
209 gacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    ||||||||||| |||||   |||||||||||||||||||  |||||| |||||| ||||| |||||| |||||    
27144443 gacacagacactgacacgccgacaccgctaataatttgaggaaatcacataatttagtgtaattatatgtgtc 27144515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 230 - 282
Target Start/End: Complemental strand, 30502446 - 30502394
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||||||||| |||||||  ||||||||||| |||||| ||||||    
30502446 acaccgctaataatttgagaaaatcacttaattcagtgtaattatatgtgtcg 30502394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 230 - 282
Target Start/End: Complemental strand, 30542789 - 30542737
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||||||||| |||||||  ||||||||||| |||||| ||||||    
30542789 acaccgctaataatttgagaaaatcacttaattcagtgtaattatatgtgtcg 30542737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 212 - 280
Target Start/End: Original strand, 39205863 - 39205931
Alignment:
212 acagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgt 280  Q
    |||||||| ||||| | ||||| ||||||||||||| ||||||||||||||  |||| |||||| ||||    
39205863 acagacacggacacgtcgacactgctaataatttgagaaaatcatataattaggtgtaattatatgtgt 39205931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 229 - 333
Target Start/End: Complemental strand, 39696058 - 39695956
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtcacgtgtccgacaccgggacacgtctcgtccaagaagtgtccg 328  Q
    |||||||  |||||||||| ||||| |||||||| ||||| || ||||||||||||||  |||||||||| ||||||||| ||  ||| || |||||| |    
39696058 gacaccgacaataatttgagaaaatgatataatttagtgtaatcataggtgtcgtgtc-ggtgtccgaca-cgggacacgcctaatcctaggagtgtcgg 39695961  T
329 tgctt 333  Q
    |||||    
39695960 tgctt 39695956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 206 - 282
Target Start/End: Complemental strand, 23016073 - 23015995
Alignment:
206 cacgacacagacaccgacacatt--gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||| |||||||||||  |  |||| || |||| |||||| ||||||| |||||||||||| |||||||||||||    
23016073 cacgacacggacaccgacactctctgacatcgttaatcatttgagaaaatcacataattcagtgtaattataggtgtcg 23015995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 231 - 282
Target Start/End: Original strand, 34879352 - 34879403
Alignment:
231 caccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||| ||||||| |||||||||||||||||||| || ||| ||||||    
34879352 caccgctaaaaatttgagaaaatcatataattcagtgtaataatatgtgtcg 34879403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 206 - 273
Target Start/End: Complemental strand, 42488135 - 42488068
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    |||||||||||||| ||||| | ||||||| | ||||||| ||||||| |||||||||| ||| ||||    
42488135 cacgacacagacactgacacgtcgacaccgttgataatttaataaaattatataattcaatgtaatta 42488068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 225 - 275
Target Start/End: Complemental strand, 17593785 - 17593735
Alignment:
225 cattgacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    |||||| |||||||||||||||| |||||||  ||||||||||| ||||||    
17593785 cattgaaaccgctaataatttgagaaaatcacgtaattcagtgtaattata 17593735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 227 - 281
Target Start/End: Original strand, 25817493 - 25817547
Alignment:
227 ttgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    ||||||| ||||||||||| | |||||||||| ||||||| |||||||| |||||    
25817493 ttgacactgctaataatttaaaaaaatcatatgattcagtatgattatatgtgtc 25817547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 215 - 273
Target Start/End: Original strand, 39698527 - 39698585
Alignment:
215 gacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    ||||| |||||  |||||| ||||||||||||| ||||||| |||||||||||| ||||    
39698527 gacactgacacgctgacacagctaataatttgaaaaaatcacataattcagtgtaatta 39698585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 209 - 262
Target Start/End: Complemental strand, 7175098 - 7175045
Alignment:
209 gacacagacaccgacacattgacaccgctaataatttgataaaatcatataatt 262  Q
    ||||| ||||| ||||||| ||||||| ||||||||||| ||||||| ||||||    
7175098 gacacggacactgacacatcgacaccgttaataatttgagaaaatcacataatt 7175045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 286
Target Start/End: Complemental strand, 7997217 - 7997168
Alignment:
237 taataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    ||||||||||| ||||| ||||||| |||||| |||||| ||||||||||    
7997217 taataatttgagaaaatgatataatacagtgtaattataagtgtcgtgtc 7997168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 215 - 268
Target Start/End: Original strand, 19438329 - 19438382
Alignment:
215 gacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgt 268  Q
    ||||| ||||||| |||| |||| ||||||||| ||||||| ||||||||||||    
19438329 gacactgacacatcgacatcgctgataatttgagaaaatcacataattcagtgt 19438382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 282
Target Start/End: Complemental strand, 21191115 - 21191062
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||||||||||||| ||||||| |||||||||||| |||| | ||||||    
21191115 gacacagctaataatttgaaaaaatcacataattcagtgtaattacaagtgtcg 21191062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 228 - 281
Target Start/End: Complemental strand, 32630795 - 32630742
Alignment:
228 tgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    |||||||| ||||||||||| ||||| |||||||||| ||| |||||| |||||    
32630795 tgacaccgataataatttgagaaaattatataattcaatgtaattatatgtgtc 32630742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 282
Target Start/End: Complemental strand, 41091316 - 41091263
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| |||||| |||||| ||||||| |||||||||||| |||||| ||||||    
41091316 gacactgctaatgatttgagaaaatcacataattcagtgtaattatatgtgtcg 41091263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 286
Target Start/End: Original strand, 43554529 - 43554578
Alignment:
237 taataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    ||||||||||| ||||| |||||||| ||||| || ||||||||||||||    
43554529 taataatttgagaaaatgatataatttagtgtaatcataggtgtcgtgtc 43554578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 209 - 281
Target Start/End: Complemental strand, 19168900 - 19168828
Alignment:
209 gacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    ||||| ||||| ||||||   ||||||||| |||||||||||||||| || ||||||||| || ||| |||||    
19168900 gacacggacactgacacacctacaccgctattaatttgataaaatcacattattcagtgtaatcatatgtgtc 19168828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 230 - 282
Target Start/End: Complemental strand, 21576803 - 21576751
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||| ||||||||||||| ||||||| |||||||||||| |||| | ||||||    
21576803 acacagctaataatttgaaaaaatcacataattcagtgtaattacaagtgtcg 21576751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 273
Target Start/End: Original strand, 27932235 - 27932279
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    ||||||||||||||||||| ||||| | |||||||||||| ||||    
27932235 gacaccgctaataatttgagaaaattacataattcagtgtaatta 27932279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 230 - 282
Target Start/End: Original strand, 36838544 - 36838596
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||||||||| ||||| | |||||| ||||| |||||| ||||||    
36838544 acaccgctaataatttgagaaaattacataatttagtgtaattatatgtgtcg 36838596  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 236 - 307
Target Start/End: Complemental strand, 38464416 - 38464344
Alignment:
236 ctaataatttgataaaatcatataattcagtgtgattataggtgtc-gtgtcacgtgtccgacaccgggacac 307  Q
    |||||||||||| ||||||| || ||||| ||  |||||| ||||| ||| ||| ||||||||||||||||||    
38464416 ctaataatttgagaaaatcacattattcattgaaattataagtgtcagtggcacatgtccgacaccgggacac 38464344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 38)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 232 - 282
Target Start/End: Complemental strand, 34691861 - 34691811
Alignment:
232 accgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||||||||||||||||||||||||||||| |||||| ||||||    
34691861 accgctaataatttgataaaatcatataattcagtgtaattatatgtgtcg 34691811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 232 - 282
Target Start/End: Complemental strand, 34714273 - 34714223
Alignment:
232 accgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||||||||||||||||||||||||||||| |||||| ||||||    
34714273 accgctaataatttgataaaatcatataattcagtgtaattatatgtgtcg 34714223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 229 - 282
Target Start/End: Complemental strand, 37411303 - 37411250
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||    
37411303 gacaccgctaataatttgagaaaatcacataattcagtgtgattatatgtgtcg 37411250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 206 - 273
Target Start/End: Complemental strand, 12941017 - 12940950
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    |||||||| ||||| ||||| |||||||  |||||||||||| |||||||||||||||||||| ||||    
12941017 cacgacacggacactgacacgttgacacaactaataatttgaaaaaatcatataattcagtgtaatta 12940950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 206 - 280
Target Start/End: Original strand, 21616739 - 21616813
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgt 280  Q
    |||||||| ||||| |||||   ||||||||||||||||||| ||||||| |||||||||||| |||||| ||||    
21616739 cacgacacggacacggacacgccgacaccgctaataatttgagaaaatcacataattcagtgtaattatatgtgt 21616813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 209 - 282
Target Start/End: Original strand, 23718006 - 23718079
Alignment:
209 gacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||||| ||||||  ||||||||||||||||||| ||| ||| |||||||||||| |||||| ||||||    
23718006 gacacggacactgacacaccgacaccgctaataatttgagaaagtcacataattcagtgtaattatatgtgtcg 23718079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 209 - 282
Target Start/End: Original strand, 24105678 - 24105751
Alignment:
209 gacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||||| ||||||  ||||||||||||||||||| ||| ||| |||||||||||| |||||| ||||||    
24105678 gacacggacactgacacaccgacaccgctaataatttgagaaagtcacataattcagtgtaattatatgtgtcg 24105751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 206 - 282
Target Start/End: Complemental strand, 20539756 - 20539680
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||| ||||| ||||| | ||||| ||||||||||||| |||||||||||||| ||||| |||| | ||||||    
20539756 cacgacacggacactgacacgtcgacacagctaataatttgaaaaaatcatataatttagtgtaattacaagtgtcg 20539680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 186 - 282
Target Start/End: Complemental strand, 30404952 - 30404856
Alignment:
186 ctatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||||| |||| || ||||| ||||| |||||   ||||| | ||||||||||| ||||||| |||||||||||| |||| | ||||||    
30404952 ctatgaagcacggatacggacatgacacggacactgacacgccgacacggttaataatttgaaaaaatcacataattcagtgtaattacaagtgtcg 30404856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 27286394 - 27286299
Alignment:
186 ctatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    |||||||||||||| || | ||||| || ||||| || ||   |||| ||||||||||||||||| |||| |||||| ||||| ||||||||||||    
27286394 ctatgaagcacggacacagacacgatacggacactgatacgccgacaacgctaataatttgataagatcacataattaagtgtaattataggtgtc 27286299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 215 - 282
Target Start/End: Complemental strand, 29970622 - 29970555
Alignment:
215 gacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||||||||||||||||||||||||||| ||||||  ||| |||||||| || ||| ||||||    
29970622 gacactgacacattgacaccgctaataatttgagaaaatcgcatagttcagtgtaatcatatgtgtcg 29970555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 229 - 275
Target Start/End: Original strand, 28677909 - 28677955
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    ||||||||||||||||||| ||||||| |||||||||||| ||||||    
28677909 gacaccgctaataatttgaaaaaatcacataattcagtgtaattata 28677955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 215 - 281
Target Start/End: Original strand, 31808063 - 31808129
Alignment:
215 gacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    ||||| ||||||  ||||||||||||||||| | ||||||| |||||||||||| |||||| |||||    
31808063 gacactgacacaccgacaccgctaataatttaacaaaatcacataattcagtgtaattatatgtgtc 31808129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 228 - 282
Target Start/End: Original strand, 44860319 - 44860373
Alignment:
228 tgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||||||||||| ||||||  |||||||||||| |||||| ||||||    
44860319 tgacaccgctaataatttgagaaaatcgcataattcagtgtaattatatgtgtcg 44860373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 209 - 286
Target Start/End: Complemental strand, 23354731 - 23354654
Alignment:
209 gacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    ||||| ||||||||||   |||||| | ||||||||||| ||||| |||||||| ||||| || ||||||||||||||    
23354731 gacacggacaccgacatgctgacacagataataatttgagaaaatgatataatttagtgtaatcataggtgtcgtgtc 23354654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 237 - 286
Target Start/End: Original strand, 25544489 - 25544538
Alignment:
237 taataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    ||||||||||| ||||| |||||||||||||| || ||||||||||||||    
25544489 taataatttgagaaaatgatataattcagtgtaatcataggtgtcgtgtc 25544538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 229 - 333
Target Start/End: Complemental strand, 42832335 - 42832237
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtcacgtgtccgacaccgggacacgtctcgtccaagaagtgtccg 328  Q
    ||||||||||||||||||| ||||| | ||| |||||||| |||||| ||||||      ||||||||| |||||||||| ||  |||||| |||||||     
42832335 gacaccgctaataatttgagaaaattacatatttcagtgtaattataagtgtcg------gtgtccgactccgggacacgcctaatccaaggagtgtcct 42832242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 206 - 274
Target Start/End: Complemental strand, 21782900 - 21782832
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattat 274  Q
    ||||||||| |||| |||||   ||||| ||||||||||||| ||||||| |||||||||||| |||||    
21782900 cacgacacaaacactgacacgccgacactgctaataatttgagaaaatcacataattcagtgtaattat 21782832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 230 - 274
Target Start/End: Original strand, 28412351 - 28412395
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattat 274  Q
    |||||| ||||||||||||||||||| |||||||||||| |||||    
28412351 acaccgttaataatttgataaaatcacataattcagtgtaattat 28412395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 221 - 268
Target Start/End: Complemental strand, 22084899 - 22084852
Alignment:
221 gacacattgacaccgctaataatttgataaaatcatataattcagtgt 268  Q
    |||||||  |||||| ||||||||||| ||||||||||||||||||||    
22084899 gacacatcaacaccgttaataatttgagaaaatcatataattcagtgt 22084852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 229 - 268
Target Start/End: Complemental strand, 24975384 - 24975345
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgt 268  Q
    ||||||||||||||||||| |||||| |||||||||||||    
24975384 gacaccgctaataatttgagaaaatcgtataattcagtgt 24975345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 207 - 282
Target Start/End: Complemental strand, 36756425 - 36756350
Alignment:
207 acgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||||| ||||| | |||||  ||||||||||||  |||| | |||||||||||| |||||| ||||||    
36756425 acgacacagacactgacacgtcgacacaactaataatttgaagaaataacataattcagtgtaattataagtgtcg 36756350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 236 - 307
Target Start/End: Original strand, 18622613 - 18622690
Alignment:
236 ctaataatttgataaaatcatataattcagtgtgattata------ggtgtcgtgtcacgtgtccgacaccgggacac 307  Q
    |||||||||| ||||||||| |||||||||||| ||||||      ||||||||||||  ||||| ||||||||||||    
18622613 ctaataatttaataaaatcacataattcagtgtaattatacgtgttggtgtcgtgtcatatgtcctacaccgggacac 18622690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 266
Target Start/End: Original strand, 1327978 - 1328015
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagt 266  Q
    ||||||||||||||||||| ||||||||| ||||||||    
1327978 gacaccgctaataatttgagaaaatcataaaattcagt 1328015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 274
Target Start/End: Complemental strand, 16069313 - 16069268
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattat 274  Q
    ||||||| ||||||||| | |||||||||||||||||||| |||||    
16069313 gacaccgttaataatttaaaaaaatcatataattcagtgtaattat 16069268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 274
Target Start/End: Original strand, 18276521 - 18276566
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattat 274  Q
    ||||||||||||||||||| |||||||  ||||||||||| |||||    
18276521 gacaccgctaataatttgagaaaatcacttaattcagtgtaattat 18276566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 286
Target Start/End: Original strand, 19573978 - 19574035
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtc 286  Q
    ||||||| ||||||||| | ||||| | |||||||||||| |||||||||| ||||||    
19573978 gacaccgataataatttaagaaaataacataattcagtgtaattataggtggcgtgtc 19574035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 237 - 282
Target Start/End: Complemental strand, 30527646 - 30527601
Alignment:
237 taataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||| |||||||||||||| ||||| |||||| ||||||    
30527646 taataatttgagaaaatcatataatttagtgtaattatatgtgtcg 30527601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 210 - 282
Target Start/End: Complemental strand, 4882774 - 4882702
Alignment:
210 acacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||| || ||||| | || ||||||||| |||||| ||||| |||||||||||||| |||| | ||||||    
4882774 acacagatactgacacgtcgataccgctaattatttgaaaaaatgatataattcagtgtaattacaagtgtcg 4882702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 232 - 264
Target Start/End: Complemental strand, 6045972 - 6045940
Alignment:
232 accgctaataatttgataaaatcatataattca 264  Q
    |||||||||||||||||||||||||| ||||||    
6045972 accgctaataatttgataaaatcatacaattca 6045940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 265
Target Start/End: Complemental strand, 8950374 - 8950338
Alignment:
229 gacaccgctaataatttgataaaatcatataattcag 265  Q
    ||||||||||||||||||| |||||| ||||||||||    
8950374 gacaccgctaataatttgaaaaaatcttataattcag 8950338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 285
Target Start/End: Complemental strand, 10535818 - 10535762
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgt 285  Q
    ||||||| ||||||||||| ||||| | |||||||||||| || ||| |||||||||    
10535818 gacaccgataataatttgagaaaatgacataattcagtgtaatcataagtgtcgtgt 10535762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 186 - 282
Target Start/End: Complemental strand, 18841115 - 18841019
Alignment:
186 ctatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||| | |||| |||||||  ||||| |||||  ||||||  |||||||||||| ||||| | |||||| ||||| |||| | ||||||    
18841115 ctatgaagcacgtatacggacacgacatggacactgacacgctgacacaactaataatttgaaaaaattacataattaagtgtaattacaagtgtcg 18841019  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 231 - 275
Target Start/End: Original strand, 25080902 - 25080946
Alignment:
231 caccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    |||||||||||||||||||| |||| |||| ||||||| ||||||    
25080902 caccgctaataatttgataagatcacataagtcagtgtaattata 25080946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 230 - 282
Target Start/End: Original strand, 31018591 - 31018643
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||||||| | ||||||| || ||| ||||| |||||||||||||    
31018591 acaccgctaataatttcagaaaatcacatgatttagtgtaattataggtgtcg 31018643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 242 - 282
Target Start/End: Complemental strand, 38355933 - 38355893
Alignment:
242 atttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||| ||||||| ||||||||||||||||||| ||||||    
38355933 atttgagaaaatcacataattcagtgtgattatatgtgtcg 38355893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 230 - 282
Target Start/End: Original strand, 39279676 - 39279728
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||| ||||||| ||| ||||||| |||||||||||| |||||| ||||||    
39279676 acaccgttaataatatgagaaaatcaaataattcagtgtaattatatgtgtcg 39279728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 273
Target Start/End: Original strand, 39323264 - 39323308
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    ||||||||||||||||||| ||||| | |||||||||||| ||||    
39323264 gacaccgctaataatttgacaaaattacataattcagtgtaatta 39323308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 28)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 229 - 333
Target Start/End: Original strand, 37203264 - 37203366
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtcacgtgtccgacaccgggacacgtctcgtccaagaagtgtccg 328  Q
    ||||| ||||||||||||| ||||| | |||||| ||||| |||| | |||| |||||  | |||||||||||||||||||||  ||| |||||||||||    
37203264 gacacggctaataatttgaaaaaatgacataatttagtgtaattacaagtgtagtgtc--gggtccgacaccgggacacgtctaatccgagaagtgtccg 37203361  T
329 tgctt 333  Q
    |||||    
37203362 tgctt 37203366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 229 - 335
Target Start/End: Complemental strand, 3712568 - 3712456
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc--gtgtc----acgtgtccgacaccgggacacgtctcgtccaagaag 322  Q
    ||||||||||||||||||| |||||||| ||||||| ||| |||||| |||||  |||||    |||||||||||||||||||||| ||  ||  || ||    
3712568 gacaccgctaataatttgagaaaatcatgtaattcaatgtaattatatgtgtctggtgtcgtagacgtgtccgacaccgggacacggctaatctgaggag 3712469  T
323 tgtccgtgcttta 335  Q
    |||||||||||||    
3712468 tgtccgtgcttta 3712456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 186 - 286
Target Start/End: Complemental strand, 22440702 - 22440602
Alignment:
186 ctatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgt 285  Q
    ||||||| |||||| || | |||||||  ||||| || |||| ||||||| ||||||||||| ||||||| |||||||||||| |||||| ||| |||||    
22440702 ctatgaaacacggatacagacacgacatggacactgatacatcgacaccgttaataatttgagaaaatcacataattcagtgtaattatatgtgacgtgt 22440603  T
286 c 286  Q
    |    
22440602 c 22440602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 206 - 301
Target Start/End: Original strand, 24343484 - 24343578
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtcacgtgtccgacaccg 301  Q
    |||||||| ||| |||||||   ||||| | ||||||||||| ||||| | |||||||||||| |||||||||||||||||  |||||||||||||    
24343484 cacgacacggacgccgacacgccgacacggataataatttgagaaaattacataattcagtgtaattataggtgtcgtgtc-ggtgtccgacaccg 24343578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 215 - 265
Target Start/End: Complemental strand, 56488583 - 56488533
Alignment:
215 gacaccgacacattgacaccgctaataatttgataaaatcatataattcag 265  Q
    ||||||||||| ||||||||||||| ||||||| |||||||||||||||||    
56488583 gacaccgacacgttgacaccgctaacaatttgagaaaatcatataattcag 56488533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 206 - 295
Target Start/End: Complemental strand, 14126193 - 14126104
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgtcacgtgtccg 295  Q
    ||||||||||||||  ||||   ||||| | ||||||||||||||| ||| |||||||||||| |||||| ||||| |||| ||||||||    
14126193 cacgacacagacactaacacgccgacactgttaataatttgataaagtcacataattcagtgtaattataagtgtcatgtctcgtgtccg 14126104  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 235 - 311
Target Start/End: Complemental strand, 35952670 - 35952588
Alignment:
235 gctaataatttgataaaatcatataattcagtgtgattata------ggtgtcgtgtcacgtgtccgacaccgggacacgtct 311  Q
    |||||||||||||||||||||||||||||| ||| ||||||       |||||||||| |||||||||||||  |||||||||    
35952670 gctaataatttgataaaatcatataattcaatgtaattatatgtatcagtgtcgtgtcgcgtgtccgacaccaagacacgtct 35952588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 7012025 - 7012115
Alignment:
188 atgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggt 278  Q
    ||||||||| || || | || ||||| |||||||||||   ||||||| ||||||||||| ||||| | ||||||||||||||| ||||||    
7012025 atgaagcacagacacagacaggacacggacaccgacacgccgacaccgataataatttgagaaaatgacataattcagtgtgatcataggt 7012115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 229 - 275
Target Start/End: Complemental strand, 8423777 - 8423731
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    ||||||||||||||||||| ||||||| |||||||||||| ||||||    
8423777 gacaccgctaataatttgagaaaatcacataattcagtgtaattata 8423731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 224 - 274
Target Start/End: Original strand, 56257928 - 56257978
Alignment:
224 acattgacaccgctaataatttgataaaatcatataattcagtgtgattat 274  Q
    |||| ||||| ||||||||||||| |||||||||||||||||||| |||||    
56257928 acatggacactgctaataatttgagaaaatcatataattcagtgtaattat 56257978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 229 - 282
Target Start/End: Original strand, 40613450 - 40613503
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||||||||||| ||||| ||||||| |||||||||||| |||||| ||||||    
40613450 gacaccgctaatattttgagaaaatcacataattcagtgtaattatatgtgtcg 40613503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 209 - 244
Target Start/End: Original strand, 35160982 - 35161017
Alignment:
209 gacacagacaccgacacattgacaccgctaataatt 244  Q
    ||||| ||||||||||||||||||||||||||||||    
35160982 gacacggacaccgacacattgacaccgctaataatt 35161017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 230 - 280
Target Start/End: Original strand, 36635325 - 36635375
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattataggtgt 280  Q
    ||||| |||||||||||| ||||||| |||||||||||| |||||| ||||    
36635325 acaccactaataatttgagaaaatcacataattcagtgtaattatatgtgt 36635375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 209 - 275
Target Start/End: Complemental strand, 40179715 - 40179649
Alignment:
209 gacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    ||||| ||||| ||||| ||||||||  ||||| ||||| ||||||| |||||||||||| ||||||    
40179715 gacacggacactgacacgttgacaccattaatagtttgaaaaaatcacataattcagtgtaattata 40179649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 236 - 282
Target Start/End: Complemental strand, 54580075 - 54580029
Alignment:
236 ctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||| ||||||| |||||||||||| |||||| ||||||    
54580075 ctaataatttgaaaaaatcacataattcagtgtaattataagtgtcg 54580029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 282
Target Start/End: Complemental strand, 999407 - 999354
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||| ||||||||||||||  ||||||||||||| ||||| |||||| ||||||    
999407 gacatcgctaataatttgagtaaatcatataatttagtgtaattatatgtgtcg 999354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 216 - 285
Target Start/End: Complemental strand, 19230381 - 19230312
Alignment:
216 acaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgtgt 285  Q
    |||| ||||||| ||||  | ||||||||||| ||||| | |||||||| ||| ||||||||||||||||    
19230381 acactgacacatggacatagataataatttgagaaaataacataattcaatgtaattataggtgtcgtgt 19230312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 282
Target Start/End: Original strand, 21945459 - 21945556
Alignment:
186 ctatgaagcacggagac-ggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||||| || || || ||||||||||| ||||    ||||| ||||||||||||| ||||| | |||||||||||| |||| | ||||||    
21945459 ctatgaagcacggacaccggacatgacacagacactgacatgccgacacagctaataatttgaaaaaatgacataattcagtgtaattacaagtgtcg 21945556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 209 - 282
Target Start/End: Complemental strand, 26504378 - 26504305
Alignment:
209 gacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| ||||| || |||| ||||| ||||||||||| | ||||||| ||| |||||||| |||||| ||||||    
26504378 gacacggacactgaaacatcgacactgctaataatttaagaaaatcaaatagttcagtgtaattatatgtgtcg 26504305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 273
Target Start/End: Complemental strand, 28964312 - 28964263
Alignment:
224 acattgacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    |||||||||  ||||||||||||| ||||||| |||||||||||| ||||    
28964312 acattgacatagctaataatttgaaaaaatcacataattcagtgtaatta 28964263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 282
Target Start/End: Original strand, 49430982 - 49431079
Alignment:
186 ctatgaagcacggagacggccacgacacagacaccgacacattgacaccgctaataatttg-ataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||||| |||| |||||| | ||||  |||||   ||||| |||||||||||| | ||||||| |||||||||||| |||| | ||||||    
49430982 ctatgaagcacggacacggacacgactcggacagtgacacgccgacacagctaataatttgaaaaaaatcacataattcagtgtaattaaaagtgtcg 49431079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 231 - 275
Target Start/End: Original strand, 903924 - 903968
Alignment:
231 caccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    ||||| ||||||||||| ||||||| |||||||||||| ||||||    
903924 caccgttaataatttgagaaaatcacataattcagtgtaattata 903968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 230 - 274
Target Start/End: Original strand, 16189710 - 16189754
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattat 274  Q
    |||||||||| ||||||| ||||||| |||||||||||| |||||    
16189710 acaccgctaaaaatttgagaaaatcacataattcagtgtaattat 16189754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 281 - 325
Target Start/End: Complemental strand, 21873359 - 21873315
Alignment:
281 cgtgtcacgtgtccgacaccgggacacgtctcgtccaagaagtgt 325  Q
    |||| ||||||||||||||||||||||||||  |||||| |||||    
21873359 cgtgacacgtgtccgacaccgggacacgtctaatccaaggagtgt 21873315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 281 - 325
Target Start/End: Complemental strand, 21929220 - 21929176
Alignment:
281 cgtgtcacgtgtccgacaccgggacacgtctcgtccaagaagtgt 325  Q
    |||| ||||||||||||||||||||||||||  |||||| |||||    
21929220 cgtgacacgtgtccgacaccgggacacgtctaatccaaggagtgt 21929176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 230 - 282
Target Start/End: Original strand, 29205445 - 29205497
Alignment:
230 acaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||| ||||||||||||| ||||||| |||||||||||| |||| | ||||||    
29205445 acacggctaataatttgaaaaaatcacataattcagtgtaattacaagtgtcg 29205497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 235 - 275
Target Start/End: Original strand, 30838216 - 30838256
Alignment:
235 gctaataatttgataaaatcatataattcagtgtgattata 275  Q
    ||||||||||||||||||| |||||||| ||||| ||||||    
30838216 gctaataatttgataaaattatataatttagtgtaattata 30838256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 273
Target Start/End: Complemental strand, 38847071 - 38847027
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    ||||| ||||||||||||| |||||||||| ||||||||| ||||    
38847071 gacacagctaataatttgaaaaaatcatattattcagtgtaatta 38847027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0022 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0022
Description:

Target: scaffold0022; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 206 - 275
Target Start/End: Original strand, 90820 - 90889
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattata 275  Q
    |||||||||||||| ||||||   |||||  ||||||||||| |||||||||||||||||||| ||||||    
90820 cacgacacagacactgacacaccaacaccattaataatttgagaaaatcatataattcagtgtaattata 90889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1528 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold1528
Description:

Target: scaffold1528; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 207 - 281
Target Start/End: Original strand, 1013 - 1087
Alignment:
207 acgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    ||||||||||| | ||||||  ||||||||||||||||||| ||||| | |||||||||||| | |||| |||||    
1013 acgacacagacgctgacacaccgacaccgctaataatttgaaaaaattacataattcagtgtaactatatgtgtc 1087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0123
Description:

Target: scaffold0123; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 228 - 282
Target Start/End: Complemental strand, 44585 - 44531
Alignment:
228 tgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||||| ||||||| ||||||| |||||||||||| |||||| ||||||    
44585 tgacaccgctaaaaatttgagaaaatcacataattcagtgtaattatatgtgtcg 44531  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0044 (Bit Score: 34; Significance: 0.0000000006; HSPs: 2)
Name: scaffold0044
Description:

Target: scaffold0044; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 286 - 331
Target Start/End: Original strand, 53258 - 53303
Alignment:
286 cacgtgtccgacaccgggacacgtctcgtccaagaagtgtccgtgc 331  Q
    |||||||||||||||||||||||| |  ||||||||||||||||||    
53258 cacgtgtccgacaccgggacacgtttaatccaagaagtgtccgtgc 53303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0044; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 232 - 282
Target Start/End: Original strand, 53183 - 53233
Alignment:
232 accgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    ||||| |||||||||| ||||||| |||||||||||| |||||| ||||||    
53183 accgccaataatttgagaaaatcacataattcagtgtaattataagtgtcg 53233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 281
Target Start/End: Complemental strand, 68309 - 68249
Alignment:
221 gacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtc 281  Q
    ||||||||  ||||| ||||||||||| |||||||||||||| ||| | ||||||||||||    
68309 gacacattagcaccgttaataatttgagaaaatcatataatttagtataattataggtgtc 68249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003 (Bit Score: 32; Significance: 0.000000009; HSPs: 2)
Name: scaffold0003
Description:

Target: scaffold0003; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 286 - 333
Target Start/End: Original strand, 241672 - 241719
Alignment:
286 cacgtgtccgacaccgggacacgtctcgtccaagaagtgtccgtgctt 333  Q
    ||||||||||||||||||||||| ||  ||| ||||||||||||||||    
241672 cacgtgtccgacaccgggacacgcctaatccgagaagtgtccgtgctt 241719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0003; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 274
Target Start/End: Original strand, 241550 - 241639
Alignment:
186 ctatgaagcacggagac-ggccacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattat 274  Q
    |||||||||||||| || || |||||||| ||||| |||||   ||||| ||||||||||||  ||||||| |||||| ||||| |||||    
241550 ctatgaagcacggacaccggacacgacacggacactgacacgccgacacagctaataatttggaaaaatcacataatttagtgtaattat 241639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0085 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0085
Description:

Target: scaffold0085; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 209 - 283
Target Start/End: Original strand, 26373 - 26447
Alignment:
209 gacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcgt 283  Q
    ||||||||||  ||||| | |||||| |||||||||||| ||||||| |||||||| |||  ||||| |||||||    
26373 gacacagacagtgacacgtcgacaccactaataatttgagaaaatcacataattcaatgtcgttatatgtgtcgt 26447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 282
Target Start/End: Original strand, 70238 - 70331
Alignment:
190 gaagcacggagacggccacga-cacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||||| |||| ||| | ||||||||| ||||  | ||||| | ||||||||||| ||||| | |||||||||||| |||||| ||||||    
70238 gaagcacggatacggacacaaacacagacacagacatgtcgacacagttaataatttgaaaaaataacataattcagtgtaattataagtgtcg 70331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0223 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 273
Target Start/End: Original strand, 20172 - 20216
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    ||||| ||||||||||||| ||||||| |||||||||||| ||||    
20172 gacacagctaataatttgaaaaaatcacataattcagtgtaatta 20216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0103 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0103
Description:

Target: scaffold0103; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 273
Target Start/End: Original strand, 51811 - 51855
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    ||||| ||||||||||||| ||||||| |||||||||||| ||||    
51811 gacacagctaataatttgaaaaaatcacataattcagtgtaatta 51855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0053 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0053
Description:

Target: scaffold0053; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 206 - 282
Target Start/End: Original strand, 8775 - 8851
Alignment:
206 cacgacacagacaccgacacattgacaccgctaataatttgataaaatcatataattcagtgtgattataggtgtcg 282  Q
    |||||||| ||||| |||||   ||||| ||||||||||||| |||||||||| ||| ||||| |||| | ||||||    
8775 cacgacacggacactgacacgccgacacagctaataatttgaaaaaatcatattatttagtgtaattacaagtgtcg 8851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 229 - 273
Target Start/End: Original strand, 92807 - 92851
Alignment:
229 gacaccgctaataatttgataaaatcatataattcagtgtgatta 273  Q
    ||||||||||||||||||| ||||| | |||||||||||| ||||    
92807 gacaccgctaataatttgagaaaattacataattcagtgtaatta 92851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 204300 times since January 2019
Visitors: 1518