View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_21_12 (Length: 537)

Name: 108_21_12
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_21_12
108_21_12
[»] chr1 (4 HSPs)
chr1 (2-139)||(30414626-30414763)
chr1 (350-487)||(30415040-30415176)
chr1 (205-285)||(30414751-30414831)
chr1 (316-359)||(30414831-30414875)


Alignment Details
Target: chr1 (Bit Score: 109; Significance: 1e-54; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 2 - 139
Target Start/End: Original strand, 30414626 - 30414763
Alignment:
2 ttacatacacagctctatttttcaataacatgattataaatgtagcttacatgttatattagatcagaaatgattcttggacatttnnnnnnntcgtgtg 101  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||| |||    
30414626 ttacttacacagctctatttttcaataacatgattataaatgtagcttacatgttatattagatcagaaatgattcttggacatttaaaaaaatcgggtg 30414725  T
102 ctagctgtagctcttctttgatttttgtttgcattttt 139  Q
    ||||||||||||||||||||||||||||||||||||||    
30414726 ctagctgtagctcttctttgatttttgtttgcattttt 30414763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 350 - 487
Target Start/End: Original strand, 30415040 - 30415176
Alignment:
350 atgatttaagcatccttgattaaatatatatcgagtgcagancaatacntaacaaagagatacccaaaagagaactactaaaagctgttaaattggagct 449  Q
    |||||||||||||||||||||||||||||||||||||||||  ||||| ||||||||||||||| |||||||||||||||||||| ||||||||||||||    
30415040 atgatttaagcatccttgattaaatatatatcgagtgcagaaaaatacataacaaagagatacc-aaaagagaactactaaaagcggttaaattggagct 30415138  T
450 tgaaggggatgacatagctataacnangggaagattac 487  Q
    |||||||||||||||||||||||  | |||||||||||    
30415139 tgaaggggatgacatagctataaataagggaagattac 30415176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 205 - 285
Target Start/End: Original strand, 30414751 - 30414831
Alignment:
205 tgtttgcatttttattnaaccattttaggaatagaatgaaataggtaatcgnanacaatatatggaagatttcaccttaca 285  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||    
30414751 tgtttgcatttttatttaaccattttaggaatagaatgaaataggtaatcgcacagaatatatggaagatttcaccttaca 30414831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 316 - 359
Target Start/End: Original strand, 30414831 - 30414875
Alignment:
316 acttccatattttcctaatcagaattat-aaagctatgatttaag 359  Q
    |||||||||||||||||||||||||||| ||||||||||||||||    
30414831 acttccatattttcctaatcagaattataaaagctatgatttaag 30414875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 314107 times since January 2019
Visitors: 446