View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_21_19 (Length: 297)

Name: 108_21_19
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_21_19
108_21_19
[»] chr8 (105 HSPs)
chr8 (1-205)||(39657418-39657618)
chr8 (1-205)||(18890624-18890824)
chr8 (1-204)||(41896482-41896681)
chr8 (1-126)||(42046264-42046385)
chr8 (1-131)||(14585715-14585841)
chr8 (1-205)||(1239322-1239517)
chr8 (1-205)||(8443436-8443632)
chr8 (1-205)||(15344277-15344472)
chr8 (1-205)||(15433342-15433537)
chr8 (1-205)||(15524646-15524841)
chr8 (1-189)||(29617199-29617379)
chr8 (2-205)||(1236623-1236817)
chr8 (1-97)||(43833921-43834017)
chr8 (1-189)||(5333413-5333593)
chr8 (20-188)||(3240365-3240525)
chr8 (1-205)||(24099175-24099376)
chr8 (1-108)||(471091-471198)
chr8 (9-179)||(21237784-21237946)
chr8 (1-205)||(45445736-45445929)
chr8 (1-84)||(7198120-7198203)
chr8 (1-88)||(8867882-8867969)
chr8 (1-86)||(16247148-16247233)
chr8 (242-291)||(18890861-18890910)
chr8 (1-202)||(10377663-10377853)
chr8 (1-96)||(16928682-16928777)
chr8 (1-91)||(20553166-20553256)
chr8 (1-91)||(20559669-20559759)
chr8 (1-91)||(20571231-20571321)
chr8 (243-295)||(1239560-1239612)
chr8 (1-96)||(23230712-23230807)
chr8 (1-96)||(27110390-27110485)
chr8 (1-91)||(7883166-7883256)
chr8 (238-295)||(14585579-14585637)
chr8 (242-295)||(37971172-37971226)
chr8 (157-205)||(14585670-14585718)
chr8 (1-205)||(37971254-37971447)
chr8 (31-91)||(40619028-40619088)
chr8 (1-205)||(17693539-17693732)
chr8 (38-204)||(24419128-24419296)
chr8 (1-84)||(31013533-31013616)
chr8 (1-91)||(14544828-14544918)
chr8 (1-205)||(14916113-14916308)
chr8 (30-83)||(17427154-17427207)
chr8 (242-283)||(20553401-20553442)
chr8 (107-189)||(36532906-36532984)
chr8 (36-108)||(8981220-8981292)
chr8 (15-91)||(10331165-10331241)
chr8 (243-295)||(15344186-15344238)
chr8 (243-295)||(15433251-15433303)
chr8 (243-295)||(15524555-15524607)
chr8 (242-282)||(41896404-41896444)
chr8 (155-205)||(5917698-5917749)
chr8 (2-81)||(24186587-24186666)
chr8 (37-96)||(33214632-33214691)
chr8 (1-108)||(33347446-33347553)
chr8 (242-283)||(20559901-20559943)
chr8 (242-283)||(20571463-20571505)
chr8 (1-86)||(28086737-28086823)
chr8 (242-295)||(31013726-31013780)
chr8 (253-295)||(39657348-39657390)
chr8 (243-296)||(5046630-5046682)
chr8 (241-291)||(8443675-8443727)
chr8 (21-82)||(8826294-8826355)
chr8 (143-204)||(20227339-20227400)
chr8 (245-295)||(23230523-23230575)
chr8 (1-82)||(26469071-26469152)
chr8 (241-294)||(40619227-40619280)
chr8 (242-295)||(7883395-7883450)
chr8 (248-295)||(8981077-8981125)
chr8 (243-287)||(25191223-25191267)
chr8 (30-82)||(27747051-27747103)
chr8 (234-282)||(33214779-33214827)
chr8 (1-96)||(3673510-3673605)
chr8 (150-185)||(9619393-9619428)
chr8 (241-295)||(9619477-9619529)
chr8 (150-185)||(11464184-11464219)
chr8 (245-295)||(28897591-28897642)
chr8 (150-185)||(32724517-32724552)
chr8 (150-185)||(33896095-33896130)
chr8 (150-185)||(44099970-44100005)
chr8 (151-185)||(4808977-4809011)
chr8 (249-287)||(8867717-8867755)
chr8 (151-185)||(11196902-11196936)
chr8 (241-283)||(14545056-14545098)
chr8 (241-295)||(24099417-24099471)
chr8 (151-185)||(34611817-34611851)
chr8 (1-91)||(39646113-39646201)
chr8 (151-185)||(43192383-43192417)
chr8 (241-274)||(2655801-2655834)
chr8 (241-294)||(3673326-3673379)
chr8 (160-197)||(7883314-7883351)
chr8 (241-274)||(9498721-9498754)
chr8 (241-274)||(14907043-14907076)
chr8 (30-83)||(17430804-17430857)
chr8 (152-185)||(19876224-19876257)
chr8 (152-185)||(28239846-28239879)
chr8 (1-86)||(40211227-40211312)
chr8 (258-294)||(1236865-1236901)
chr8 (241-269)||(11196827-11196855)
chr8 (241-269)||(15597285-15597313)
chr8 (241-269)||(19876149-19876177)
chr8 (241-269)||(26469351-26469379)
chr8 (241-269)||(32724608-32724636)
chr8 (46-82)||(33896176-33896212)
chr8 (3-86)||(34609915-34609998)
[»] chr5 (85 HSPs)
chr5 (1-205)||(14211188-14211388)
chr5 (1-204)||(28540833-28541032)
chr5 (1-205)||(2979233-2979433)
chr5 (2-205)||(19103395-19103594)
chr5 (1-108)||(39567324-39567431)
chr5 (1-204)||(8088139-8088333)
chr5 (1-193)||(10332474-10332659)
chr5 (1-205)||(13007197-13007390)
chr5 (238-293)||(28541066-28541121)
chr5 (238-295)||(2979466-2979523)
chr5 (1-82)||(26878035-26878116)
chr5 (145-205)||(39567263-39567323)
chr5 (1-205)||(38597765-38597958)
chr5 (238-293)||(39567175-39567230)
chr5 (2-96)||(34945459-34945553)
chr5 (1-91)||(35920923-35921013)
chr5 (238-295)||(19103627-19103684)
chr5 (1-205)||(35850767-35850960)
chr5 (1-97)||(41630567-41630663)
chr5 (1-84)||(10722839-10722922)
chr5 (1-91)||(6216969-6217059)
chr5 (238-295)||(14211110-14211165)
chr5 (4-205)||(31391683-31391873)
chr5 (1-96)||(9113652-9113747)
chr5 (242-295)||(10722652-10722705)
chr5 (4-96)||(13421999-13422091)
chr5 (1-204)||(6012065-6012257)
chr5 (1-96)||(14726388-14726483)
chr5 (241-287)||(11977093-11977139)
chr5 (242-295)||(38597675-38597728)
chr5 (241-285)||(8096654-8096698)
chr5 (31-91)||(11073857-11073917)
chr5 (31-91)||(14082353-14082413)
chr5 (2-86)||(15571562-15571646)
chr5 (1-197)||(19120886-19121073)
chr5 (1-96)||(38007424-38007519)
chr5 (151-197)||(1582160-1582206)
chr5 (151-197)||(1602609-1602655)
chr5 (241-287)||(15571372-15571418)
chr5 (1-91)||(24229711-24229801)
chr5 (242-287)||(34945307-34945353)
chr5 (243-292)||(8088371-8088419)
chr5 (242-295)||(24229942-24229995)
chr5 (1-86)||(25980234-25980318)
chr5 (244-292)||(26825311-26825360)
chr5 (160-197)||(26825406-26825443)
chr5 (150-187)||(42886484-42886521)
chr5 (244-295)||(6012297-6012349)
chr5 (31-91)||(7036290-7036350)
chr5 (241-292)||(26878235-26878287)
chr5 (241-295)||(2057957-2058009)
chr5 (241-287)||(7036113-7036160)
chr5 (241-295)||(10649362-10649414)
chr5 (1-96)||(11976862-11976957)
chr5 (155-205)||(20270821-20270872)
chr5 (241-295)||(30371633-30371685)
chr5 (150-185)||(30371734-30371769)
chr5 (150-185)||(34881726-34881761)
chr5 (150-185)||(41184476-41184511)
chr5 (241-283)||(4771030-4771072)
chr5 (38-104)||(8984919-8984985)
chr5 (241-294)||(8985089-8985143)
chr5 (242-295)||(9113882-9113936)
chr5 (151-185)||(10649652-10649686)
chr5 (242-295)||(13007106-13007160)
chr5 (150-188)||(19349679-19349717)
chr5 (151-185)||(36344528-36344562)
chr5 (241-274)||(6216798-6216831)
chr5 (31-96)||(7930243-7930308)
chr5 (160-205)||(9113800-9113845)
chr5 (241-274)||(26578177-26578210)
chr5 (241-269)||(1696985-1697013)
chr5 (241-269)||(3271527-3271555)
chr5 (46-82)||(7150289-7150325)
chr5 (46-82)||(19280899-19280935)
chr5 (241-269)||(20257813-20257841)
chr5 (241-269)||(21060400-21060428)
chr5 (241-269)||(27266979-27267007)
chr5 (241-269)||(30298141-30298169)
chr5 (241-269)||(34881642-34881670)
chr5 (241-269)||(35475455-35475483)
chr5 (243-295)||(38007235-38007286)
chr5 (239-283)||(41214774-41214818)
chr5 (241-269)||(42579813-42579841)
chr5 (241-269)||(43261936-43261964)
[»] chr2 (130 HSPs)
chr2 (1-205)||(10237144-10237344)
chr2 (1-205)||(3308917-3309117)
chr2 (1-205)||(14955501-14955701)
chr2 (1-202)||(17249075-17249267)
chr2 (20-205)||(32448566-32448742)
chr2 (2-205)||(10929640-10929836)
chr2 (1-197)||(29574556-29574744)
chr2 (51-205)||(6358849-6358997)
chr2 (2-108)||(41694686-41694792)
chr2 (1-190)||(24461431-24461615)
chr2 (1-91)||(1421758-1421848)
chr2 (238-295)||(10237367-10237424)
chr2 (1-96)||(4778830-4778925)
chr2 (1-194)||(23933547-23933732)
chr2 (238-295)||(3308827-3308884)
chr2 (238-294)||(14955412-14955468)
chr2 (1-89)||(17994658-17994746)
chr2 (1-205)||(38445145-38445338)
chr2 (2-205)||(7677802-7677994)
chr2 (4-185)||(14423321-14423494)
chr2 (1-96)||(37876534-37876629)
chr2 (2-96)||(19062281-19062375)
chr2 (1-91)||(31210535-31210625)
chr2 (1-91)||(33585663-33585753)
chr2 (1-91)||(37416792-37416882)
chr2 (1-188)||(28533882-28534061)
chr2 (1-89)||(37994368-37994456)
chr2 (5-108)||(6436672-6436775)
chr2 (1-96)||(31128708-31128803)
chr2 (1-136)||(4904073-4904204)
chr2 (1-86)||(9169186-9169271)
chr2 (242-295)||(18763356-18763409)
chr2 (31-108)||(30399993-30400070)
chr2 (243-295)||(1415453-1415505)
chr2 (37-205)||(1415536-1415693)
chr2 (3-91)||(29173650-29173738)
chr2 (1-88)||(16376024-16376111)
chr2 (1-96)||(27097335-27097429)
chr2 (244-295)||(32448782-32448832)
chr2 (150-204)||(12647989-12648043)
chr2 (242-295)||(31788344-31788398)
chr2 (1-91)||(36691956-36692046)
chr2 (241-295)||(37994162-37994216)
chr2 (242-295)||(4041752-4041805)
chr2 (1-86)||(19028842-19028927)
chr2 (242-295)||(19062510-19062563)
chr2 (1-86)||(36943049-36943134)
chr2 (1-96)||(7646550-7646650)
chr2 (3-91)||(12677380-12677468)
chr2 (31-91)||(31788538-31788598)
chr2 (1-97)||(39310781-39310876)
chr2 (32-108)||(41327568-41327644)
chr2 (1-96)||(7448324-7448419)
chr2 (241-292)||(23933778-23933829)
chr2 (1-96)||(25508996-25509091)
chr2 (1-96)||(33923782-33923877)
chr2 (242-287)||(4098999-4099045)
chr2 (241-287)||(12648081-12648127)
chr2 (38-108)||(17151488-17151558)
chr2 (40-82)||(25087128-25087170)
chr2 (241-295)||(42949624-42949677)
chr2 (242-295)||(7448136-7448189)
chr2 (242-283)||(9169415-9169456)
chr2 (1-86)||(29279498-29279583)
chr2 (241-293)||(29279727-29279780)
chr2 (241-282)||(43397277-43397318)
chr2 (234-290)||(19597771-19597827)
chr2 (46-82)||(20047036-20047072)
chr2 (243-287)||(28227844-28227888)
chr2 (146-202)||(37994258-37994314)
chr2 (155-205)||(13268679-13268730)
chr2 (155-205)||(17068871-17068922)
chr2 (155-205)||(19953677-19953728)
chr2 (150-185)||(20047118-20047153)
chr2 (155-205)||(25623001-25623052)
chr2 (150-185)||(27249187-27249222)
chr2 (241-295)||(27249270-27249322)
chr2 (241-284)||(29574790-29574833)
chr2 (241-295)||(30420587-30420639)
chr2 (241-295)||(36233915-36233967)
chr2 (148-205)||(36943188-36943242)
chr2 (150-189)||(37416702-37416741)
chr2 (150-185)||(40659968-40660003)
chr2 (151-185)||(2808509-2808543)
chr2 (31-85)||(4041552-4041606)
chr2 (151-185)||(4228143-4228177)
chr2 (242-295)||(4778641-4778695)
chr2 (151-185)||(7015748-7015782)
chr2 (160-202)||(7448229-7448271)
chr2 (151-185)||(9986379-9986413)
chr2 (241-295)||(11985387-11985441)
chr2 (1-91)||(18763550-18763640)
chr2 (163-205)||(27097485-27097527)
chr2 (243-281)||(28871921-28871959)
chr2 (241-283)||(29173876-29173918)
chr2 (151-185)||(30420688-30420722)
chr2 (242-295)||(38445054-38445108)
chr2 (160-198)||(42698777-42698815)
chr2 (160-205)||(4099082-4099127)
chr2 (155-203)||(7443522-7443571)
chr2 (242-283)||(7678029-7678070)
chr2 (241-294)||(8971745-8971798)
chr2 (46-91)||(11833559-11833604)
chr2 (150-195)||(14416157-14416202)
chr2 (234-283)||(33923602-33923651)
chr2 (152-205)||(34128755-34128808)
chr2 (150-183)||(36234020-36234053)
chr2 (46-82)||(84135-84171)
chr2 (242-283)||(1421574-1421617)
chr2 (241-269)||(3270347-3270375)
chr2 (241-269)||(4192773-4192801)
chr2 (241-269)||(6173566-6173594)
chr2 (243-295)||(6436496-6436548)
chr2 (242-295)||(7646360-7646415)
chr2 (150-186)||(8308180-8308216)
chr2 (4-96)||(8809357-8809449)
chr2 (155-202)||(17118769-17118817)
chr2 (160-204)||(18763448-18763492)
chr2 (243-287)||(19029066-19029110)
chr2 (241-273)||(19596033-19596065)
chr2 (241-269)||(21570527-21570555)
chr2 (22-82)||(24587798-24587858)
chr2 (241-269)||(27949357-27949385)
chr2 (241-273)||(31128936-31128968)
chr2 (241-269)||(31581838-31581866)
chr2 (46-82)||(32679064-32679100)
chr2 (241-269)||(34598922-34598950)
chr2 (241-269)||(40660050-40660078)
chr2 (46-86)||(42698674-42698714)
chr2 (7-82)||(45128295-45128371)
[»] chr7 (100 HSPs)
chr7 (2-205)||(24350767-24350964)
chr7 (1-205)||(28476191-28476390)
chr7 (1-205)||(22742908-22743108)
chr7 (2-205)||(35132911-35133110)
chr7 (67-205)||(1749140-1749274)
chr7 (1-204)||(24069321-24069516)
chr7 (1-205)||(9450064-9450257)
chr7 (2-197)||(41553362-41553549)
chr7 (238-295)||(22742818-22742875)
chr7 (1-205)||(19296841-19297034)
chr7 (1-96)||(12141235-12141330)
chr7 (8-197)||(38880512-38880693)
chr7 (2-103)||(4999957-5000058)
chr7 (238-295)||(48930660-48930717)
chr7 (1-77)||(48930795-48930871)
chr7 (2-205)||(30756747-30756939)
chr7 (1-205)||(34899534-34899727)
chr7 (146-205)||(48930737-48930796)
chr7 (1-91)||(39171517-39171607)
chr7 (238-295)||(35132831-35132888)
chr7 (46-197)||(41553751-41553894)
chr7 (4-205)||(42978581-42978771)
chr7 (2-86)||(46700114-46700198)
chr7 (1-91)||(48316739-48316829)
chr7 (238-295)||(24350997-24351054)
chr7 (1-136)||(11343843-11343973)
chr7 (1-91)||(19404684-19404774)
chr7 (242-295)||(30756976-30757030)
chr7 (2-108)||(35665063-35665169)
chr7 (238-287)||(1749297-1749345)
chr7 (238-283)||(28476113-28476158)
chr7 (234-295)||(37837608-37837669)
chr7 (1-205)||(38798752-38798945)
chr7 (46-197)||(41554096-41554239)
chr7 (2-97)||(5078342-5078437)
chr7 (37-96)||(24770315-24770374)
chr7 (241-295)||(19404911-19404965)
chr7 (2-84)||(28044684-28044766)
chr7 (2-91)||(8001474-8001563)
chr7 (109-190)||(969478-969555)
chr7 (37-205)||(39328753-39328910)
chr7 (243-291)||(39328951-39328999)
chr7 (1-96)||(13796856-13796951)
chr7 (37-197)||(37837421-37837570)
chr7 (1-96)||(40993226-40993321)
chr7 (150-185)||(46822021-46822056)
chr7 (6-80)||(969391-969465)
chr7 (31-97)||(1769135-1769201)
chr7 (244-282)||(3394365-3394403)
chr7 (242-287)||(9450294-9450340)
chr7 (107-204)||(26623819-26623909)
chr7 (242-295)||(34899764-34899818)
chr7 (1-91)||(47590385-47590475)
chr7 (1-91)||(48061496-48061586)
chr7 (67-204)||(3394443-3394574)
chr7 (242-295)||(13797089-13797142)
chr7 (143-204)||(44311852-44311913)
chr7 (241-282)||(49148248-49148289)
chr7 (26-82)||(13592442-13592498)
chr7 (151-187)||(32521964-32522000)
chr7 (2-82)||(43369682-43369762)
chr7 (241-295)||(2843346-2843398)
chr7 (48-136)||(5348566-5348650)
chr7 (150-185)||(6002027-6002062)
chr7 (155-205)||(13008629-13008680)
chr7 (143-182)||(19560007-19560046)
chr7 (150-185)||(32684674-32684709)
chr7 (1-96)||(45349726-45349821)
chr7 (241-295)||(46821920-46821972)
chr7 (243-289)||(1769343-1769389)
chr7 (38-96)||(5792865-5792923)
chr7 (241-287)||(24770143-24770189)
chr7 (241-287)||(27996977-27997023)
chr7 (151-185)||(46339060-46339094)
chr7 (48-102)||(46822712-46822766)
chr7 (241-283)||(47590204-47590246)
chr7 (160-202)||(47590285-47590327)
chr7 (242-295)||(48316969-48317023)
chr7 (148-205)||(5775174-5775231)
chr7 (247-295)||(8013627-8013676)
chr7 (241-274)||(21266317-21266350)
chr7 (250-291)||(24069607-24069648)
chr7 (164-205)||(40993153-40993194)
chr7 (155-203)||(43483709-43483758)
chr7 (242-287)||(46699933-46699978)
chr7 (241-269)||(1448948-1448976)
chr7 (243-287)||(5348747-5348790)
chr7 (241-269)||(5546289-5546317)
chr7 (247-283)||(11343690-11343726)
chr7 (242-295)||(12141464-12141519)
chr7 (241-269)||(20116513-20116541)
chr7 (46-82)||(22927824-22927860)
chr7 (241-273)||(25067987-25068019)
chr7 (243-295)||(25255118-25255169)
chr7 (241-269)||(32684615-32684643)
chr7 (248-295)||(35665295-35665343)
chr7 (241-269)||(35667350-35667378)
chr7 (241-269)||(42067179-42067207)
chr7 (242-283)||(48061314-48061357)
chr7 (241-269)||(48207832-48207860)
[»] chr3 (142 HSPs)
chr3 (1-205)||(51923688-51923888)
chr3 (5-204)||(16235388-16235583)
chr3 (1-205)||(7546575-7546776)
chr3 (1-205)||(51303570-51303770)
chr3 (1-205)||(21289741-21289941)
chr3 (1-205)||(8914673-8914873)
chr3 (1-205)||(27706153-27706353)
chr3 (1-205)||(42460714-42460910)
chr3 (1-205)||(35175369-35175565)
chr3 (1-205)||(53807785-53807980)
chr3 (1-108)||(628850-628957)
chr3 (65-201)||(51487075-51487207)
chr3 (3-108)||(14859544-14859649)
chr3 (1-108)||(50194262-50194369)
chr3 (1-136)||(4821837-4821967)
chr3 (20-204)||(29239309-29239485)
chr3 (1-108)||(29922111-29922218)
chr3 (1-108)||(29971264-29971371)
chr3 (42-197)||(12947242-12947389)
chr3 (242-292)||(51923611-51923661)
chr3 (1-91)||(52923044-52923134)
chr3 (1-205)||(9998435-9998628)
chr3 (238-294)||(51303793-51303849)
chr3 (1-205)||(53508190-53508387)
chr3 (1-96)||(7448841-7448936)
chr3 (1-96)||(7456983-7457078)
chr3 (1-96)||(21431679-21431774)
chr3 (1-91)||(45568372-45568462)
chr3 (1-205)||(47041975-47042169)
chr3 (238-295)||(7546488-7546547)
chr3 (1-108)||(26716034-26716141)
chr3 (241-292)||(29921934-29921985)
chr3 (241-292)||(29971087-29971138)
chr3 (1-205)||(40487293-40487486)
chr3 (1-96)||(40556768-40556863)
chr3 (1-108)||(52115948-52116055)
chr3 (1-91)||(9797461-9797551)
chr3 (241-295)||(33579746-33579800)
chr3 (242-295)||(36461588-36461642)
chr3 (238-291)||(42460628-42460682)
chr3 (2-84)||(43488518-43488600)
chr3 (238-295)||(21289974-21290030)
chr3 (1-86)||(21533736-21533821)
chr3 (242-295)||(52923274-52923327)
chr3 (1-205)||(6954623-6954816)
chr3 (1-205)||(10233038-10233231)
chr3 (4-108)||(19339230-19339333)
chr3 (31-91)||(32701562-32701622)
chr3 (1-205)||(36461358-36461551)
chr3 (235-289)||(22290821-22290876)
chr3 (1-96)||(44805096-44805190)
chr3 (156-205)||(4019702-4019752)
chr3 (1-91)||(45424869-45424959)
chr3 (55-172)||(7887424-7887535)
chr3 (239-295)||(37040649-37040706)
chr3 (1-77)||(3085228-3085304)
chr3 (244-295)||(9998345-9998397)
chr3 (244-295)||(10108114-10108166)
chr3 (1-197)||(10229452-10229637)
chr3 (244-295)||(10232948-10233000)
chr3 (242-293)||(36910798-36910850)
chr3 (4-96)||(46304450-46304542)
chr3 (243-291)||(53808024-53808072)
chr3 (1-64)||(4711580-4711643)
chr3 (1-108)||(20464897-20465004)
chr3 (1-96)||(21313102-21313197)
chr3 (1-96)||(33579946-33580041)
chr3 (241-295)||(47042208-47042263)
chr3 (241-292)||(50194440-50194491)
chr3 (242-295)||(6954853-6954907)
chr3 (1-51)||(12946894-12946944)
chr3 (242-295)||(21431502-21431556)
chr3 (1-91)||(26739284-26739374)
chr3 (242-295)||(43488747-43488801)
chr3 (1-91)||(45425663-45425753)
chr3 (241-291)||(52116167-52116217)
chr3 (241-291)||(53508103-53508153)
chr3 (242-295)||(54148866-54148920)
chr3 (1-75)||(54149078-54149152)
chr3 (241-290)||(4396488-4396536)
chr3 (160-205)||(10108204-10108249)
chr3 (244-292)||(10229357-10229406)
chr3 (5-86)||(12149715-12149796)
chr3 (5-86)||(20608830-20608911)
chr3 (160-205)||(38545767-38545812)
chr3 (160-205)||(40556680-40556725)
chr3 (148-197)||(41818185-41818234)
chr3 (1-86)||(41818291-41818376)
chr3 (151-187)||(36734729-36734765)
chr3 (4-84)||(48199855-48199935)
chr3 (1-96)||(10108302-10108397)
chr3 (150-185)||(25162439-25162474)
chr3 (241-288)||(32245450-32245497)
chr3 (150-185)||(35499234-35499269)
chr3 (241-295)||(35499320-35499372)
chr3 (150-185)||(36906125-36906160)
chr3 (162-205)||(38860197-38860240)
chr3 (244-287)||(40487211-40487254)
chr3 (234-285)||(43016745-43016795)
chr3 (241-295)||(47896029-47896084)
chr3 (150-185)||(49552260-49552295)
chr3 (1-48)||(51487209-51487256)
chr3 (1-108)||(53099844-53099951)
chr3 (252-293)||(953566-953608)
chr3 (241-275)||(1649318-1649352)
chr3 (1-59)||(7792114-7792172)
chr3 (1-91)||(12050575-12050665)
chr3 (243-281)||(12116009-12116047)
chr3 (238-291)||(16235301-16235354)
chr3 (37-91)||(18011091-18011145)
chr3 (1-91)||(23799837-23799927)
chr3 (241-295)||(35175277-35175331)
chr3 (37-91)||(35864895-35864949)
chr3 (151-185)||(42719520-42719554)
chr3 (37-91)||(43016926-43016980)
chr3 (242-287)||(45568601-45568647)
chr3 (1-91)||(48650661-48650751)
chr3 (243-291)||(629064-629113)
chr3 (246-294)||(7449063-7449112)
chr3 (246-294)||(7457205-7457254)
chr3 (248-289)||(7887572-7887612)
chr3 (242-283)||(9319947-9319988)
chr3 (242-283)||(9797686-9797727)
chr3 (241-274)||(14464430-14464463)
chr3 (241-282)||(20465126-20465167)
chr3 (33-86)||(31271768-31271821)
chr3 (242-287)||(31271964-31272009)
chr3 (241-274)||(32607390-32607423)
chr3 (241-269)||(2342419-2342447)
chr3 (153-205)||(3606741-3606793)
chr3 (46-82)||(3848873-3848909)
chr3 (241-269)||(4172494-4172522)
chr3 (241-269)||(17237730-17237758)
chr3 (241-269)||(25631646-25631674)
chr3 (241-269)||(31794007-31794035)
chr3 (151-187)||(31794072-31794108)
chr3 (30-82)||(31794155-31794207)
chr3 (251-291)||(38142453-38142493)
chr3 (241-269)||(38440696-38440724)
chr3 (1-86)||(38860039-38860126)
chr3 (30-82)||(46178653-46178705)
chr3 (241-269)||(46934570-46934598)
[»] chr4 (138 HSPs)
chr4 (1-202)||(36194694-36194890)
chr4 (1-205)||(27651926-27652125)
chr4 (1-205)||(31891214-31891414)
chr4 (1-205)||(18935764-18935964)
chr4 (1-199)||(1621436-1621622)
chr4 (1-202)||(52944300-52944493)
chr4 (1-205)||(33332496-33332694)
chr4 (1-204)||(28857389-28857583)
chr4 (1-96)||(47320339-47320434)
chr4 (1-202)||(51888138-51888331)
chr4 (1-189)||(22038729-22038909)
chr4 (6-205)||(22300835-22301026)
chr4 (1-205)||(36204306-36204508)
chr4 (9-197)||(9643382-9643562)
chr4 (1-205)||(4142679-4142875)
chr4 (1-86)||(21686169-21686254)
chr4 (1-205)||(22611172-22611365)
chr4 (1-182)||(2069507-2069680)
chr4 (1-108)||(36161786-36161893)
chr4 (1-91)||(2520871-2520961)
chr4 (1-205)||(6155150-6155348)
chr4 (238-291)||(27651850-27651903)
chr4 (238-294)||(18935685-18935741)
chr4 (1-205)||(32766503-32766696)
chr4 (238-294)||(36194612-36194668)
chr4 (1-108)||(9048739-9048846)
chr4 (1-96)||(53811115-53811210)
chr4 (1-96)||(56040573-56040668)
chr4 (2-91)||(19853440-19853529)
chr4 (238-293)||(1621651-1621707)
chr4 (241-292)||(9713809-9713860)
chr4 (1-96)||(21662524-21662619)
chr4 (1-96)||(21671288-21671383)
chr4 (1-108)||(37465558-37465664)
chr4 (1-106)||(9713989-9714092)
chr4 (1-91)||(24098994-24099084)
chr4 (242-294)||(24099227-24099280)
chr4 (1-86)||(33921151-33921236)
chr4 (1-82)||(38166157-38166238)
chr4 (1-86)||(45418609-45418694)
chr4 (243-292)||(47320560-47320609)
chr4 (241-294)||(52944211-52944264)
chr4 (1-205)||(53444107-53444300)
chr4 (6-81)||(9145823-9145898)
chr4 (1-96)||(10496422-10496517)
chr4 (240-291)||(31891444-31891495)
chr4 (148-199)||(43853434-43853485)
chr4 (1-108)||(48351113-48351220)
chr4 (1-96)||(54021947-54022042)
chr4 (1-91)||(10258823-10258913)
chr4 (1-91)||(13634207-13634297)
chr4 (242-295)||(21686398-21686452)
chr4 (15-85)||(35395621-35395691)
chr4 (146-204)||(52934008-52934066)
chr4 (251-292)||(21223447-21223488)
chr4 (243-292)||(35348207-35348256)
chr4 (1-74)||(43510305-43510378)
chr4 (242-294)||(22038958-22039009)
chr4 (1-77)||(43853549-43853625)
chr4 (242-295)||(56040801-56040856)
chr4 (241-295)||(5119237-5119292)
chr4 (252-295)||(22063948-22063991)
chr4 (1-91)||(31359673-31359764)
chr4 (37-205)||(35348296-35348453)
chr4 (31-82)||(37030362-37030413)
chr4 (146-205)||(47320455-47320514)
chr4 (242-295)||(2520675-2520729)
chr4 (242-295)||(4142912-4142965)
chr4 (241-283)||(9643291-9643333)
chr4 (242-295)||(19853669-19853723)
chr4 (242-287)||(22611089-22611135)
chr4 (242-295)||(32766412-32766466)
chr4 (241-283)||(36161622-36161664)
chr4 (242-295)||(53810926-53810980)
chr4 (241-294)||(54021760-54021814)
chr4 (241-290)||(18048790-18048838)
chr4 (242-292)||(22558621-22558673)
chr4 (37-86)||(26633634-26633683)
chr4 (113-188)||(9145917-9145992)
chr4 (151-187)||(9645586-9645622)
chr4 (4-96)||(17949254-17949346)
chr4 (4-96)||(17953106-17953198)
chr4 (151-187)||(18138950-18138986)
chr4 (153-205)||(35395741-35395793)
chr4 (2-82)||(36700377-36700457)
chr4 (243-295)||(37030162-37030214)
chr4 (3-91)||(42032458-42032545)
chr4 (165-205)||(49072808-49072848)
chr4 (151-187)||(49126163-49126199)
chr4 (150-185)||(868180-868215)
chr4 (150-185)||(4643876-4643911)
chr4 (150-185)||(8009397-8009432)
chr4 (241-295)||(9165198-9165253)
chr4 (150-185)||(9528913-9528948)
chr4 (241-291)||(9634576-9634627)
chr4 (150-205)||(19896604-19896659)
chr4 (253-292)||(21225344-21225383)
chr4 (253-292)||(21231780-21231819)
chr4 (244-295)||(22300743-22300794)
chr4 (150-185)||(25273901-25273936)
chr4 (241-280)||(29120519-29120558)
chr4 (150-185)||(29965653-29965688)
chr4 (31-82)||(35964914-35964965)
chr4 (241-295)||(47416802-47416854)
chr4 (150-185)||(47417680-47417715)
chr4 (150-185)||(53616686-53616721)
chr4 (151-185)||(10389791-10389825)
chr4 (163-205)||(26633749-26633791)
chr4 (241-295)||(35261109-35261162)
chr4 (245-291)||(35395836-35395882)
chr4 (151-185)||(43444411-43444445)
chr4 (241-294)||(44596563-44596617)
chr4 (1-86)||(44596759-44596842)
chr4 (241-295)||(51888373-51888427)
chr4 (241-275)||(52978743-52978777)
chr4 (241-274)||(2115707-2115740)
chr4 (150-187)||(2624512-2624549)
chr4 (241-274)||(9528997-9529030)
chr4 (242-287)||(26633828-26633873)
chr4 (241-274)||(29965571-29965604)
chr4 (241-274)||(43444330-43444363)
chr4 (242-283)||(43510110-43510151)
chr4 (5-78)||(51535352-51535424)
chr4 (241-274)||(53616770-53616803)
chr4 (241-269)||(1531849-1531877)
chr4 (243-287)||(2069737-2069781)
chr4 (241-269)||(2624440-2624468)
chr4 (241-269)||(8009478-8009506)
chr4 (165-205)||(13634104-13634144)
chr4 (241-269)||(25273822-25273850)
chr4 (241-269)||(37188711-37188739)
chr4 (241-269)||(38706829-38706857)
chr4 (241-273)||(43095551-43095583)
chr4 (241-269)||(43154140-43154168)
chr4 (160-204)||(44596654-44596698)
chr4 (65-97)||(47158311-47158343)
chr4 (241-269)||(51317928-51317956)
chr4 (1-77)||(55228084-55228160)
[»] chr1 (118 HSPs)
chr1 (1-202)||(48750153-48750350)
chr1 (1-205)||(34413019-34413217)
chr1 (1-199)||(36775637-36775831)
chr1 (1-205)||(16161803-16161993)
chr1 (1-169)||(37720076-37720240)
chr1 (1-205)||(47132872-47133068)
chr1 (1-205)||(24582920-24583115)
chr1 (1-205)||(44543242-44543437)
chr1 (1-205)||(49626883-49627078)
chr1 (1-195)||(41994406-41994592)
chr1 (1-205)||(19060879-19061074)
chr1 (3-171)||(16262864-16263024)
chr1 (6-196)||(12635148-12635330)
chr1 (1-96)||(14872709-14872804)
chr1 (237-295)||(34413243-34413302)
chr1 (238-289)||(48750076-48750127)
chr1 (1-91)||(43412449-43412539)
chr1 (243-295)||(49626791-49626843)
chr1 (1-205)||(5983808-5984001)
chr1 (1-91)||(7337590-7337680)
chr1 (1-91)||(32679068-32679158)
chr1 (1-91)||(35484318-35484408)
chr1 (28-97)||(24597278-24597347)
chr1 (238-295)||(36775870-36775926)
chr1 (1-97)||(25564067-25564163)
chr1 (1-96)||(10776388-10776483)
chr1 (1-96)||(21947545-21947640)
chr1 (1-91)||(9341801-9341891)
chr1 (1-91)||(45415633-45415723)
chr1 (241-294)||(15435029-15435082)
chr1 (2-91)||(32395073-32395162)
chr1 (148-204)||(32679161-32679217)
chr1 (244-295)||(568943-568993)
chr1 (1-80)||(15492373-15492452)
chr1 (1-108)||(18939377-18939484)
chr1 (1-96)||(23291569-23291664)
chr1 (37-96)||(31919058-31919117)
chr1 (67-204)||(34528700-34528829)
chr1 (1-96)||(44915709-44915804)
chr1 (1-187)||(3228259-3228434)
chr1 (2-80)||(31984247-31984325)
chr1 (243-293)||(44543155-44543204)
chr1 (248-294)||(47132782-47132828)
chr1 (1-89)||(13075582-13075670)
chr1 (3-96)||(35461978-35462071)
chr1 (242-295)||(45789446-45789498)
chr1 (242-295)||(11462604-11462659)
chr1 (1-81)||(31317821-31317901)
chr1 (242-294)||(32394881-32394933)
chr1 (238-282)||(37720274-37720318)
chr1 (15-78)||(26535437-26535500)
chr1 (241-295)||(1742162-1742216)
chr1 (1-108)||(6217750-6217861)
chr1 (242-295)||(7337820-7337874)
chr1 (241-295)||(12635048-12635102)
chr1 (249-291)||(13075800-13075842)
chr1 (238-292)||(16161716-16161770)
chr1 (241-287)||(23291799-23291845)
chr1 (242-295)||(45415440-45415494)
chr1 (245-294)||(13144972-13145021)
chr1 (47-96)||(15431639-15431688)
chr1 (234-287)||(26535284-26535337)
chr1 (243-295)||(34528600-34528650)
chr1 (37-190)||(34878241-34878383)
chr1 (242-294)||(35462194-35462247)
chr1 (242-283)||(35484548-35484589)
chr1 (31-96)||(51916622-51916687)
chr1 (243-291)||(19060787-19060835)
chr1 (234-293)||(27456424-27456484)
chr1 (7-82)||(50166013-50166089)
chr1 (150-185)||(5701269-5701304)
chr1 (150-185)||(7997799-7997834)
chr1 (150-185)||(9687240-9687275)
chr1 (3-86)||(27580057-27580140)
chr1 (150-185)||(28035149-28035184)
chr1 (241-291)||(31918874-31918925)
chr1 (150-185)||(40881048-40881083)
chr1 (150-185)||(45426102-45426137)
chr1 (1-91)||(13144739-13144829)
chr1 (245-283)||(16262755-16262792)
chr1 (241-294)||(19716016-19716067)
chr1 (242-283)||(21947775-21947817)
chr1 (242-295)||(29738793-29738847)
chr1 (241-283)||(31984074-31984116)
chr1 (151-185)||(35584655-35584689)
chr1 (37-91)||(49504558-49504612)
chr1 (160-205)||(1742253-1742298)
chr1 (160-205)||(10776536-10776581)
chr1 (241-289)||(15492180-15492226)
chr1 (243-292)||(18939206-18939254)
chr1 (241-274)||(20266231-20266264)
chr1 (160-205)||(21686845-21686890)
chr1 (241-286)||(24597479-24597524)
chr1 (241-274)||(25728078-25728111)
chr1 (241-274)||(35584740-35584773)
chr1 (150-187)||(39927590-39927627)
chr1 (15-91)||(568721-568797)
chr1 (241-269)||(3871343-3871371)
chr1 (46-82)||(7342813-7342849)
chr1 (160-204)||(7836871-7836915)
chr1 (46-82)||(9172581-9172617)
chr1 (46-82)||(9180563-9180599)
chr1 (1-37)||(14489401-14489437)
chr1 (241-269)||(14545454-14545482)
chr1 (241-269)||(18569429-18569457)
chr1 (244-292)||(21686756-21686804)
chr1 (7-82)||(25406198-25406274)
chr1 (241-269)||(27872673-27872701)
chr1 (241-269)||(28035073-28035101)
chr1 (241-269)||(30818464-30818492)
chr1 (46-82)||(33817122-33817158)
chr1 (46-82)||(33876592-33876628)
chr1 (243-291)||(34479378-34479425)
chr1 (241-269)||(34519067-34519095)
chr1 (243-287)||(34878430-34878474)
chr1 (165-205)||(35484471-35484511)
chr1 (151-183)||(39987401-39987433)
chr1 (30-82)||(39987480-39987532)
[»] chr6 (84 HSPs)
chr6 (1-204)||(545994-546194)
chr6 (1-205)||(8102689-8102889)
chr6 (1-205)||(1523371-1523571)
chr6 (1-205)||(14801790-14801990)
chr6 (1-205)||(30776635-30776826)
chr6 (9-204)||(30493500-30493687)
chr6 (1-197)||(31296795-31296983)
chr6 (2-189)||(26588400-26588579)
chr6 (1-205)||(606174-606367)
chr6 (4-91)||(1933622-1933709)
chr6 (1-91)||(3913501-3913591)
chr6 (2-108)||(31852121-31852227)
chr6 (1-89)||(34185620-34185708)
chr6 (8-91)||(7976121-7976204)
chr6 (1-204)||(23128589-23128781)
chr6 (6-204)||(28981145-28981335)
chr6 (1-91)||(12170541-12170631)
chr6 (1-197)||(528277-528465)
chr6 (1-205)||(33053095-33053288)
chr6 (1-96)||(127737-127832)
chr6 (1-96)||(29255373-29255468)
chr6 (238-295)||(14801086-14801143)
chr6 (8-205)||(32191664-32191851)
chr6 (4-108)||(27097572-27097676)
chr6 (1-108)||(9380079-9380186)
chr6 (2-96)||(29319806-29319900)
chr6 (1-91)||(32327144-32327234)
chr6 (238-287)||(545911-545960)
chr6 (238-295)||(30776545-30776602)
chr6 (242-295)||(606083-606137)
chr6 (242-295)||(12170374-12170428)
chr6 (1-91)||(30608442-30608532)
chr6 (3-108)||(679165-679270)
chr6 (238-283)||(8102611-8102656)
chr6 (242-294)||(33053325-33053378)
chr6 (238-294)||(1523287-1523342)
chr6 (65-189)||(22571457-22571574)
chr6 (2-82)||(29743079-29743159)
chr6 (36-96)||(30894668-30894728)
chr6 (242-295)||(3913731-3913785)
chr6 (242-295)||(68158-68211)
chr6 (31-84)||(3355197-3355250)
chr6 (107-185)||(23947315-23947389)
chr6 (241-282)||(28981069-28981110)
chr6 (1-86)||(34018638-34018723)
chr6 (241-289)||(30493416-30493463)
chr6 (160-204)||(32059880-32059924)
chr6 (151-187)||(33543657-33543693)
chr6 (150-185)||(8028154-8028189)
chr6 (150-185)||(8196443-8196478)
chr6 (241-295)||(8496871-8496923)
chr6 (150-185)||(8496973-8497008)
chr6 (234-273)||(11321618-11321657)
chr6 (38-97)||(24227696-24227755)
chr6 (150-185)||(25064242-25064277)
chr6 (241-295)||(30894515-30894570)
chr6 (2-96)||(67929-68023)
chr6 (1-91)||(7515129-7515219)
chr6 (151-185)||(7881139-7881173)
chr6 (160-202)||(32327292-32327334)
chr6 (242-287)||(32327374-32327420)
chr6 (241-282)||(678997-679038)
chr6 (2-91)||(4010440-4010529)
chr6 (241-274)||(7876164-7876197)
chr6 (241-274)||(7881222-7881255)
chr6 (152-205)||(7976247-7976300)
chr6 (241-294)||(24227867-24227920)
chr6 (241-274)||(25064160-25064193)
chr6 (241-274)||(33109759-33109792)
chr6 (150-187)||(34489254-34489291)
chr6 (241-269)||(4984697-4984725)
chr6 (241-269)||(8028237-8028265)
chr6 (241-269)||(8196526-8196554)
chr6 (46-82)||(10228766-10228802)
chr6 (241-269)||(12165771-12165799)
chr6 (241-269)||(12652870-12652898)
chr6 (46-82)||(16419245-16419281)
chr6 (241-269)||(17334705-17334733)
chr6 (241-269)||(23947436-23947464)
chr6 (169-205)||(31852272-31852308)
chr6 (242-282)||(32059800-32059840)
chr6 (241-269)||(33740697-33740725)
chr6 (1-53)||(34222906-34222958)
chr6 (46-82)||(35001677-35001713)
[»] scaffold0888 (2 HSPs)
scaffold0888 (1-205)||(1605-1805)
scaffold0888 (238-292)||(1828-1882)
[»] scaffold0347 (2 HSPs)
scaffold0347 (1-205)||(5996-6192)
scaffold0347 (243-292)||(5894-5943)
[»] scaffold0039 (2 HSPs)
scaffold0039 (1-205)||(93072-93269)
scaffold0039 (248-289)||(92984-93025)
[»] scaffold0009 (2 HSPs)
scaffold0009 (1-108)||(58015-58122)
scaffold0009 (241-295)||(58236-58290)
[»] scaffold0042 (1 HSPs)
scaffold0042 (1-108)||(92423-92530)
[»] scaffold0262 (1 HSPs)
scaffold0262 (1-86)||(1746-1831)
[»] scaffold0088 (2 HSPs)
scaffold0088 (1-91)||(50848-50938)
scaffold0088 (242-294)||(50665-50718)
[»] scaffold0017 (2 HSPs)
scaffold0017 (1-91)||(32674-32764)
scaffold0017 (242-295)||(32905-32959)
[»] scaffold0121 (1 HSPs)
scaffold0121 (2-91)||(31202-31291)
[»] scaffold0127 (2 HSPs)
scaffold0127 (1-96)||(15559-15654)
scaffold0127 (245-295)||(15370-15420)
[»] scaffold0136 (2 HSPs)
scaffold0136 (241-287)||(37933-37979)
scaffold0136 (31-91)||(9999-10059)
[»] scaffold0015 (1 HSPs)
scaffold0015 (1-91)||(3968-4057)
[»] scaffold0445 (2 HSPs)
scaffold0445 (1-204)||(1314-1506)
scaffold0445 (241-295)||(1222-1276)
[»] scaffold0050 (1 HSPs)
scaffold0050 (1-96)||(65969-66064)
[»] scaffold0049 (1 HSPs)
scaffold0049 (1-84)||(71227-71310)
[»] scaffold0128 (1 HSPs)
scaffold0128 (1-86)||(36902-36987)
[»] scaffold0634 (1 HSPs)
scaffold0634 (5-86)||(8589-8670)
[»] scaffold0026 (1 HSPs)
scaffold0026 (34-91)||(71824-71881)
[»] scaffold0113 (1 HSPs)
scaffold0113 (107-189)||(36684-36762)
[»] scaffold0003 (1 HSPs)
scaffold0003 (150-185)||(361835-361870)
[»] scaffold0884 (2 HSPs)
scaffold0884 (1-91)||(1900-1990)
scaffold0884 (252-295)||(2138-2183)
[»] scaffold0603 (1 HSPs)
scaffold0603 (241-291)||(7599-7648)
[»] scaffold0340 (1 HSPs)
scaffold0340 (27-61)||(11608-11642)
[»] scaffold0495 (1 HSPs)
scaffold0495 (46-82)||(5485-5521)
[»] scaffold0311 (1 HSPs)
scaffold0311 (241-269)||(8650-8678)
[»] scaffold0219 (1 HSPs)
scaffold0219 (1-85)||(14798-14881)
[»] scaffold0146 (1 HSPs)
scaffold0146 (241-269)||(16441-16469)
[»] scaffold0021 (1 HSPs)
scaffold0021 (1-61)||(4274-4334)
[»] scaffold0014 (1 HSPs)
scaffold0014 (241-269)||(201490-201518)
[»] scaffold0002 (1 HSPs)
scaffold0002 (151-187)||(453936-453972)


Alignment Details
Target: chr8 (Bit Score: 152; Significance: 2e-80; HSPs: 105)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 39657618 - 39657418
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| ||    
39657618 caaataatatgatgaaatctaaatcaccagaatacccatgcttctggatctgcaacgttgacgtccaaatcattgattgaatttatgattgtctgaagct 39657519  T
101 gatctttctttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaacgtcgcactaag 200  Q
     |    |||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| ||||||||||||||||    
39657518 aa----tctttcaatacgaaccaaacgaacaccgcacaacaaaagatgcgaaatcaaacaacgccgcacaagacgacgaacaatacaacgtcgcactaag 39657423  T
201 acgac 205  Q
    |||||    
39657422 acgac 39657418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 18890624 - 18890824
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    ||||||||||||| |||| |||||||||| |||||| ||| |||||||||||||||||||| | ||||||||||||||||||||||||||||||||| ||    
18890624 caaataatatgataaaatctaaatcaccataatacctatgtttctggatctgcaacgttgacgcccaaatcattgattgaatttgtgattgtctgaagct 18890723  T
101 gatctttctttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaacgtcgcactaag 200  Q
    ||||||    |||||||||||||||| |||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||    
18890724 gatctt----tcaatacgaaccaaacgaacaccacacaacaaaaaatgcgaaatcaaacaacgtcgcacaagacgacgaacaacacaacgtcgcactaag 18890819  T
201 acgac 205  Q
    |||||    
18890820 acgac 18890824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 41896681 - 41896482
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    |||||||||||||||||| |||||||||||||||| ||||||||| ||||||||||||||||| | |||||||| |||||||||||||||||||||| ||    
41896681 caaataatatgatgaaatctaaatcaccagaatactcatgcttctagatctgcaacgttgatgcctaaatcattaattgaatttgtgattgtctgaagct 41896582  T
101 gatctttctttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaacgtcgcactaag 200  Q
    ||    |||||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||||| ||| ||||||||||||||| ||||||    
41896581 ga----tctttcaatacgaaccaaacgaacaccgcacaacaaaatatgtgaaatcaaacaacgccgcacaagacgaccaacaacacaacgtcgtactaag 41896486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 42046385 - 42046264
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||||||| ||    
42046385 caaataatatgatgaaatctaaatcaccagaatacccatgcttctggatctgcaacattgacgcccaaatcattgattgaatttgtgattgtctgaagct 42046286  T
101 gatctttctttcaatacgaaccaaac 126  Q
    ||    ||||||||||||||||||||    
42046285 ga----tctttcaatacgaaccaaac 42046264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 14585841 - 14585715
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    |||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| ||    
14585841 caaataatatgatgaaatctaaatcaccaggatacccatgcttctggatctgcaacgttgacgtccaaatcaatgattgaatttgtgattgtctgaagct 14585742  T
101 gatctttctttcaatacgaaccaaacaaaca 131  Q
    ||    | |||||||||||||||||| ||||    
14585741 ga----tatttcaatacgaaccaaacgaaca 14585715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 1239322 - 1239517
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    |||||| ||||||  ||| |||||||||||||||| | ||||||||||||||||||||||| ||||| |||||||||||||| |||||||| |||||  |    
1239322 caaatagtatgatataatctaaatcaccagaatactcttgcttctggatctgcaacgttgacgtccagatcattgattgaatatgtgattgactgaagtt 1239421  T
101 gatctttctttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaacgtcgcactaag 200  Q
    ||    |||||||||| ||||| ||| |||||||||    | || |||| ||||||||||||||||||||||| || ||||||||||| |||||||| ||    
1239422 ga----tctttcaatatgaacc-aacgaacaccgca----acaagatgccaaatcaaacaacgccgcacaagacgatgaacaacacaaggtcgcacttag 1239512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 8443436 - 8443632
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    ||||||||||||| |||| |||||||||| ||||||  |||||| ||||||||||||||||||||||||||||||||||||| |||||||| |||||  |    
8443436 caaataatatgatcaaatctaaatcaccataataccagtgcttccggatctgcaacgttgatgtccaaatcattgattgaatatgtgattgactgaagtt 8443535  T
101 gatctttctttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaacgtcgcactaag 200  Q
    ||    ||||||||   ||||||||| ||||| |||    | || | ||| |||||||||||||||||||||| |||||||||||||||  |||||| ||    
8443536 ga----tctttcaaattgaaccaaacgaacactgca----acaagacgcggaatcaaacaacgccgcacaagacgacgaacaacacaacaccgcacttag 8443627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 15344472 - 15344277
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    |||||||||||||  ||| |||||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||| |||||||| |||||  |    
15344472 caaataatatgatataatctaaatcaccagaatactcttgcttctggatctgcaacgttgacgtccaaatcattgattgaatctgtgattgactgaactt 15344373  T
101 gatctttctttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaacgtcgcactaag 200  Q
    ||    |||||||||| ||||| ||| |||||||||    | || |||  ||||||||| ||||||||||||| |||||||||||||| || ||||| ||    
15344372 ga----tctttcaatatgaacc-aacgaacaccgca----acaagatgtcaaatcaaactacgccgcacaagacgacgaacaacacaaggttgcacttag 15344282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 15433537 - 15433342
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    |||||||||||||  ||| |||||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||| |||||||| |||||  |    
15433537 caaataatatgatataatctaaatcaccagaatactcttgcttctggatctgcaacgttgacgtccaaatcattgattgaatctgtgattgactgaactt 15433438  T
101 gatctttctttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaacgtcgcactaag 200  Q
    ||    |||||||||| ||||| ||| |||||||||    | || |||  ||||||||| ||||||||||||| |||||||||||||| || ||||| ||    
15433437 ga----tctttcaatatgaacc-aacgaacaccgca----acaagatgtcaaatcaaactacgccgcacaagacgacgaacaacacaaggttgcacttag 15433347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 15524841 - 15524646
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    |||||||||||||  ||| |||||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||| |||||||| |||||  |    
15524841 caaataatatgatataatctaaatcaccagaatactcttgcttctggatctgcaacgttgacgtccaaatcattgattgaatctgtgattgactgaactt 15524742  T
101 gatctttctttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaacgtcgcactaag 200  Q
    ||    |||||||||| ||||| ||| |||||||||    | || |||  ||||||||| ||||||||||||| |||||||||||||| || ||||| ||    
15524741 ga----tctttcaatatgaacc-aacgaacaccgca----acaagatgtcaaatcaaactacgccgcacaagacgacgaacaacacaaggttgcacttag 15524651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 29617199 - 29617379
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    ||||||||||||| |||| ||||||||||||||| | ||| || ||||||||||||||||| |||||||||||||||||||| |||||||| |||||  |    
29617199 caaataatatgataaaatctaaatcaccagaataacaatgtttatggatctgcaacgttgacgtccaaatcattgattgaatctgtgattgactgaagtt 29617298  T
101 gatctttctttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaac 189  Q
    |     |||||||||| ||||||||| |||||||||    | || | ||||||||||||| |||||||||||| |||||||||||||||    
29617299 g----gtctttcaataagaaccaaacgaacaccgca----acaagacgcgaaatcaaacagcgccgcacaagacgacgaacaacacaac 29617379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 2 - 205
Target Start/End: Original strand, 1236623 - 1236817
Alignment:
2 aaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaactg 101  Q
    ||||| ||||||  ||| |||||||||||||||| | ||||||||||||||||||||||| ||||| |||||||||||||| |||||||| |||||  ||    
1236623 aaatagtatgatataatctaaatcaccagaatactcttgcttctggatctgcaacgttgacgtccagatcattgattgaatatgtgattgactgaagttg 1236722  T
102 atctttctttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaacgtcgcactaaga 201  Q
    |    |||||||||| ||||| ||| |||||||||    | || |||| |||||||||||||||||||||||  ||||||||||||| |||||||| |||    
1236723 a----tctttcaatatgaacc-aacgaacaccgca----acaagatgccaaatcaaacaacgccgcacaagacaacgaacaacacaaggtcgcacttaga 1236813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 43833921 - 43834017
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaa 97  Q
    ||||||||||||| |||  |||||||||||||||| ||||||||| ||||||||||||||| ||| |||||||||||||||||||||||||||||||    
43833921 caaataatatgataaaaactaaatcaccagaatactcatgcttctagatctgcaacgttgacgtctaaatcattgattgaatttgtgattgtctgaa 43834017  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 5333593 - 5333413
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    ||||||||||||  |||| |||||||| ||||||| ||||||||||||||| ||||||||| | |||||| ||||||||||| |||||||| |||||  |    
5333593 caaataatatgacaaaatctaaatcactagaatactcatgcttctggatctacaacgttgacgcccaaataattgattgaatatgtgattgactgaagtt 5333494  T
101 gatctttctttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaac 189  Q
    ||    |||||||||| ||||||||| ||||||| |    | || | || |||||||||||| |||||||||| |||||||||||||||    
5333493 ga----tctttcaataggaaccaaacgaacaccgga----acaagacgcaaaatcaaacaacaccgcacaagacgacgaacaacacaac 5333413  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 20 - 188
Target Start/End: Complemental strand, 3240525 - 3240365
Alignment:
20 taaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaactgatctttctttcaatacga 119  Q
    |||||||||||||||||||| |||||||||||||||| |||  ||||||||||| |||||||| |||||||| ||||| | ||    ||||||||||  |    
3240525 taaatcaccagaatacccatacttctggatctgcaacattggcgtccaaatcatcgattgaatatgtgattgactgaagccga----tctttcaatatta 3240430  T
120 accaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaa 188  Q
    |||||||||||||  ||||||  || | |||||||||||||||| || |||||| ||||||||||||||    
3240429 accaaacaaacac--cacaac--aacacgcgaaatcaaacaacgtcgtacaagacgacgaacaacacaa 3240365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 24099175 - 24099376
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgt-----gattgtctg 95  Q
    ||||||||||||| |||| |||||||||| ||||  | | |||| |||||||||||||||| || ||||||||||| |||||||||     ||||| |||    
24099175 caaataatatgataaaatctaaatcaccaaaatattctttcttccggatctgcaacgttgacgtacaaatcattgaatgaatttgtgatgcgattgactg 24099274  T
96 aaactgatctttctttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaacgtcgca 195  Q
    || ||||    | |||||||| ||||||||  |||||||||    | || ||||||||||||||||||| | ||| || |||||||||||||||||||||    
24099275 aagctga----tttttcaatatgaaccaaatgaacaccgca----acaagatgcgaaatcaaacaacgcggtacaggacgacgaacaacacaacgtcgca 24099366  T
196 ctaagacgac 205  Q
    || |||||||    
24099367 ctcagacgac 24099376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 471091 - 471198
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    ||||||||||||| |||| ||||||| ||||||||||||||||| |||||||||||||||| |  ||||||||||||||||| | ||||||  ||||  |    
471091 caaataatatgataaaatctaaatcatcagaatacccatgcttccggatctgcaacgttgacgcacaaatcattgattgaatctatgattgagtgaagat 471190  T
101 gatctttc 108  Q
    ||||||||    
471191 gatctttc 471198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 9 - 179
Target Start/End: Complemental strand, 21237946 - 21237784
Alignment:
9 atgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaactgatctttc 108  Q
    ||||| |||| ||||||| |||| ||| |||||||||||||||||||| |||| |||||||||||||||||||| || |||||  ||||||||     ||    
21237946 atgataaaatctaaatcaacagagtacacatgcttctggatctgcaacattgacgtccaaatcattgattgaatatgggattgattgaaactg----gtc 21237851  T
109 tttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacga 179  Q
    |||||||| ||||||||| ||||| |||    | || | ||||| |||||||||||| ||||||| |||||    
21237850 tttcaatatgaaccaaacgaacactgca----acaagacgcgaagtcaaacaacgccccacaagatgacga 21237784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 45445736 - 45445929
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    ||||||||||||| |||| ||| |||||| ||| | |||||||| |||| | ||||||||| | ||||||||||| |||||||||| |||| ||||  |     
45445736 caaataatatgataaaatctaagtcaccaaaattcacatgcttccggattttcaacgttgacgcccaaatcattggttgaatttgtaattgactgatgcc 45445835  T
101 gatctttctttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaacgtcgcactaag 200  Q
    ||    |||||||||| |||  |||||||||||||     | ||||||||||||||   |||||||||||||| ||||||||| ||||||||| ||| ||    
45445836 ga----tctttcaataggaaataaacaaacaccgc----gacaaaatgcgaaatca---aacgccgcacaagacgacgaacaatacaacgtcgtacttag 45445924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 7198120 - 7198203
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaattt 84  Q
    ||||||||||||| |||| |||||||||| ||||  |||||||| ||||||||||||||||  |||||||||||||||||||||    
7198120 caaataatatgataaaatctaaatcaccaaaatattcatgcttccggatctgcaacgttgacatccaaatcattgattgaattt 7198203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 8867969 - 8867882
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtga 88  Q
    ||||||||||||| |||| ||||||||||||||| ||| |||||  ||||| |||| |||||| ||||||||||||||||||||||||    
8867969 caaataatatgataaaatctaaatcaccagaatatccaagcttccagatcttcaactttgatgcccaaatcattgattgaatttgtga 8867882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 16247148 - 16247233
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgt 86  Q
    ||||||||||||| |||| ||| ||| |  |||||||||||||| ||||||||||| |||||| ||||||||||||||||||||||    
16247148 caaataatatgatcaaatctaagtcagcgaaatacccatgcttccggatctgcaacattgatgcccaaatcattgattgaatttgt 16247233  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 242 - 291
Target Start/End: Original strand, 18890861 - 18890910
Alignment:
242 atgtgaaaatcacttatttagattgaaagaaaggggaaaaaagatgcaga 291  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
18890861 atgtgaaaatcacttatttagattgaaagaaaggggaaaaaagatgcaga 18890910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 10377853 - 10377663
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    ||||||||||||| |||  ||| || ||  |||||||||||||| |||||||||||||||||||||||||||||| |||||||| | |||| ||||        
10377853 caaataatatgataaaacttaagtcgccgaaatacccatgcttccggatctgcaacgttgatgtccaaatcattggttgaatttataattgactgatgta 10377754  T
101 gatctttctttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaacgtcgcactaag 200  Q
    ||    |||||||||| ||||  |||||||||  ||| ||  |||| |||||||||   |||||||||||||| | |||||||||||||| |||||| ||    
10377753 ga----tctttcaataggaactgaacaaacac--cacgac--aaaacgcgaaatca---aacgccgcacaagacggcgaacaacacaacgccgcacttag 10377665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 16928682 - 16928777
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctga 96  Q
    ||||||||||||| |||  ||| |||||  |||||||| ||||  |||||||||||||||||||||||||||||| |||||||||| |||| ||||    
16928682 caaataatatgataaaacctaagtcaccgaaatacccacgctttcggatctgcaacgttgatgtccaaatcattggttgaatttgtaattgactga 16928777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 20553166 - 20553256
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattg 91  Q
    ||||||||||||| |||  ||| |||||  ||||| |||||||| |||||||||||||||| ||||||||||||| |||||||||| ||||    
20553166 caaataatatgataaaacctaagtcaccgaaatactcatgcttccggatctgcaacgttgacgtccaaatcattgcttgaatttgtaattg 20553256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 20559669 - 20559759
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattg 91  Q
    ||||||||||||| |||  ||| |||||  ||||| |||||||| |||||||||||||||| ||||||||||||| |||||||||| ||||    
20559669 caaataatatgataaaacctaagtcaccgaaatactcatgcttccggatctgcaacgttgacgtccaaatcattgcttgaatttgtaattg 20559759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 20571231 - 20571321
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattg 91  Q
    ||||||||||||| |||  ||| |||||  ||||| |||||||| |||||||||||||||| ||||||||||||| |||||||||| ||||    
20571231 caaataatatgataaaacctaagtcaccgaaatactcatgcttccggatctgcaacgttgacgtccaaatcattgcttgaatttgtaattg 20571321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 243 - 295
Target Start/End: Original strand, 1239560 - 1239612
Alignment:
243 tgtgaaaatcacttatttagattgaaagaaaggggaaaaaagatgcagagggg 295  Q
    |||||||||||||||||||||| ||| ||||||||||||||||||||||||||    
1239560 tgtgaaaatcacttatttagatcgaacgaaaggggaaaaaagatgcagagggg 1239612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 23230807 - 23230712
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctga 96  Q
    ||||||||||||| |||  ||| |||||  |||||||||||||| |||||||||||||||| | |||| |||||| |||||||||| |||| ||||    
23230807 caaataatatgataaaacctaagtcaccgaaatacccatgcttccggatctgcaacgttgacgcccaagtcattggttgaatttgtaattgactga 23230712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 1 - 96
Target Start/End: Original strand, 27110390 - 27110485
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctga 96  Q
    ||||||||||||| |||| ||| |||| | ||||| ||||||||  ||||||||||||||| |  |||||||||||||||||||||  ||||||||    
27110390 caaataatatgataaaatctaagtcactaaaatacacatgcttccagatctgcaacgttgacgctcaaatcattgattgaatttgtagttgtctga 27110485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 7883166 - 7883256
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattg 91  Q
    ||||||||||||| |||  ||| |||||  |||||||||||||| |||||||||||| ||| |||||||| |||| |||||||||| ||||    
7883166 caaataatatgataaaacctaagtcaccgaaatacccatgcttccggatctgcaacgctgacgtccaaattattgcttgaatttgtaattg 7883256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 238 - 295
Target Start/End: Complemental strand, 14585637 - 14585579
Alignment:
238 atgtatgtgaaaatcacttatttagattgaaag-aaaggggaaaaaagatgcagagggg 295  Q
    ||||||||||||||||||||||||||||||||| |||| | ||||||||||||||||||    
14585637 atgtatgtgaaaatcacttatttagattgaaagaaaagagaaaaaaagatgcagagggg 14585579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 242 - 295
Target Start/End: Complemental strand, 37971226 - 37971172
Alignment:
242 atgtgaaaatcacttatttagattgaaag-aaaggggaaaaaagatgcagagggg 295  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||| |||||||    
37971226 atgtgaaaatcacttatttagattgaaagaaaaggggaaaaaagatgtagagggg 37971172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 14585718 - 14585670
Alignment:
157 aacaacgccgcacaagaagacgaacaacacaacgtcgcactaagacgac 205  Q
    ||||||||||||||||| |||||||||||||||||||| ||||||||||    
14585718 aacaacgccgcacaagacgacgaacaacacaacgtcgcgctaagacgac 14585670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 37971447 - 37971254
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    |||||||| |||| |||  ||| |||||  ||||| |||| ||| |||||||||||||||| ||||||||||||| |||||||||| ||||  |||        
37971447 caaataatgtgataaaacctaagtcaccgaaatactcatgtttccggatctgcaacgttgacgtccaaatcattgcttgaatttgtaattgattgatgta 37971348  T
101 gatctttctttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaacgtcgcactaag 200  Q
    ||    |||||||||| ||||  |||||||||    ||  |||||| |||||||||   |||||||||||||| ||||||||||| |||| |||||| ||    
37971347 ga----tctttcaataggaactgaacaaacac----cacgaaaaaaagcgaaatca---aacgccgcacaagacgacgaacaacaaaacgccgcacttag 37971259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 31 - 91
Target Start/End: Original strand, 40619028 - 40619088
Alignment:
31 aatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattg 91  Q
    ||||| ||||||||||||||||||||||||| | |||||| ||||||||||||||| ||||    
40619028 aatactcatgcttctggatctgcaacgttgacgcccaaattattgattgaatttgtaattg 40619088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 17693539 - 17693732
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    ||||||||||||| |||  ||| ||| |  ||||| |||||||| |||||||||| ||||| | ||||||||||| |||||||||| |||| ||||   |    
17693539 caaataatatgataaaacataagtcatcgaaatactcatgcttccggatctgcaatgttgacgcccaaatcattggttgaatttgtaattgactga---t 17693635  T
101 gatctttctttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaacgtcgcactaag 200  Q
    | ||  ||||| |||| |||| |||||||||||||     | |||| || ||||||   |||||||||||||||||||||||| |||||  |||||| ||    
17693636 g-tcgatcttttaataggaactaaacaaacaccgc----gacaaaacgcaaaatca---aacgccgcacaagaagacgaacaatacaacaccgcacttag 17693727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 38 - 204
Target Start/End: Original strand, 24419128 - 24419296
Alignment:
38 atgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaactgatctt------tctttcaatacgaaccaaacaaaca 131  Q
    |||||||||||| | ||||||||| ||| |||||||||||||||| | || ||| ||||||||||||||      |||||||||| ||||||||  ||||    
24419128 atgcttctggatttacaacgttgacgtcaaaatcattgattgaatatttggttgactgaaactgatctttcaatatctttcaatatgaaccaaatgaaca 24419227  T
132 ccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaacgtcgcactaagacga 204  Q
       |||||| ||| |  ||||||||||||| | | ||||| | |||||| ||||||||| |||||| ||||||    
24419228 --tcacaaccaaaca--cgaaatcaaacaatgtctcacaatacgacgaaaaacacaacgccgcactcagacga 24419296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 31013533 - 31013616
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaattt 84  Q
    ||||||||||||| |||  ||| ||||   ||||| |||||||| | |||||||||||||| ||||||||||||||||||||||    
31013533 caaataatatgataaaacttaagtcactgaaatacacatgcttccgaatctgcaacgttgacgtccaaatcattgattgaattt 31013616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 14544828 - 14544918
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattg 91  Q
    ||||||||||||| |||| ||| |||||  ||| |||||||||| |||||||||||||||| | |||||| ||||||| || |||| ||||    
14544828 caaataatatgataaaatttaagtcaccgaaattcccatgcttccggatctgcaacgttgacgcccaaataattgatttaacttgtaattg 14544918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 14916113 - 14916308
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    |||| |||||||| |||| ||||||| || ||||  |||||||| ||||||||||| | || |||||||||||||||||||| | ||||||  ||||  |    
14916113 caaacaatatgataaaatctaaatcaaca-aatattcatgcttccggatctgcaacatggacgtccaaatcattgattgaatctctgattgattgaagtt 14916211  T
101 gatctttctttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaacgtcgcactaag 200  Q
    |     |||||||||| ||||||||| |||||||  |||||| | ||  |||||||||||  ||||||||| | |||| ||||| ||||| |||||  ||    
14916212 g----gtctttcaatatgaaccaaacgaacaccg--caacaagacat--gaaatcaaacagtgccgcacaaaaggacggacaacgcaacgccgcacccag 14916303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 17427154 - 17427207
Alignment:
30 gaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatt 83  Q
    ||||||||||| |||||||||| ||| ||||| |||||||||||||||||||||    
17427154 gaatacccatgtttctggatcttcaatgttgacgtccaaatcattgattgaatt 17427207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #44
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 242 - 283
Target Start/End: Original strand, 20553401 - 20553442
Alignment:
242 atgtgaaaatcacttatttagattgaaagaaaggggaaaaaa 283  Q
    |||||||||||||||||||||||||||||||| |||||||||    
20553401 atgtgaaaatcacttatttagattgaaagaaaagggaaaaaa 20553442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 107 - 189
Target Start/End: Complemental strand, 36532984 - 36532906
Alignment:
107 tctttcaatacgaaccaaacaaacaccgcacaacaaaaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaac 189  Q
    |||||||||| |||||||| |||||||    || | |||||| ||||||||||||| |||||||||| |||||||||||||||    
36532984 tctttcaataggaaccaaataaacacc----aaaacaaaatgagaaatcaaacaacaccgcacaagacgacgaacaacacaac 36532906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #46
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 36 - 108
Target Start/End: Complemental strand, 8981292 - 8981220
Alignment:
36 ccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaactgatctttc 108  Q
    ||||||||| ||||||| |||||||| |||||||||||  ||||||| |||||||| ||||  ||||||||||    
8981292 ccatgcttccggatctgtaacgttgacgtccaaatcatcaattgaatctgtgattgactgacgctgatctttc 8981220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #47
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 15 - 91
Target Start/End: Complemental strand, 10331241 - 10331165
Alignment:
15 aaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattg 91  Q
    |||| |||||||| ||||||| ||||||||||||||| || |||||| || ||||| ||||||||||| | ||||||    
10331241 aaatctaaatcactagaatactcatgcttctggatctacaccgttgacgttcaaattattgattgaatctttgattg 10331165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #48
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 243 - 295
Target Start/End: Complemental strand, 15344238 - 15344186
Alignment:
243 tgtgaaaatcacttatttagattgaaagaaaggggaaaaaagatgcagagggg 295  Q
    ||||||||||||||||||||||  | | |||||||||||||||||||||||||    
15344238 tgtgaaaatcacttatttagatccatataaaggggaaaaaagatgcagagggg 15344186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #49
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 243 - 295
Target Start/End: Complemental strand, 15433303 - 15433251
Alignment:
243 tgtgaaaatcacttatttagattgaaagaaaggggaaaaaagatgcagagggg 295  Q
    ||||||||||||||||||||||  | | |||||||||||||||||||||||||    
15433303 tgtgaaaatcacttatttagatccatataaaggggaaaaaagatgcagagggg 15433251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #50
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 243 - 295
Target Start/End: Complemental strand, 15524607 - 15524555
Alignment:
243 tgtgaaaatcacttatttagattgaaagaaaggggaaaaaagatgcagagggg 295  Q
    ||||||||||||||||||||||  | | |||||||||||||||||||||||||    
15524607 tgtgaaaatcacttatttagatccatataaaggggaaaaaagatgcagagggg 15524555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #51
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 242 - 282
Target Start/End: Complemental strand, 41896444 - 41896404
Alignment:
242 atgtgaaaatcacttatttagattgaaagaaaggggaaaaa 282  Q
    ||||||||||||||||||||||||||||||||||| |||||    
41896444 atgtgaaaatcacttatttagattgaaagaaagggaaaaaa 41896404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #52
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 155 - 205
Target Start/End: Original strand, 5917698 - 5917749
Alignment:
155 caaacaacgccgcacaa-gaagacgaacaacacaacgtcgcactaagacgac 205  Q
    ||||||||| ||||||| || |||||||||||||||||||||||||||||||    
5917698 caaacaacgtcgcacaaagacgacgaacaacacaacgtcgcactaagacgac 5917749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #53
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 2 - 81
Target Start/End: Original strand, 24186587 - 24186666
Alignment:
2 aaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaa 81  Q
    |||||||||||| |||| ||| ||||   |||||||||||||  |||||||||||||||| | |||||| ||||||||||    
24186587 aaataatatgataaaatttaagtcactgaaatacccatgctttcggatctgcaacgttgacgcccaaattattgattgaa 24186666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #54
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 37 - 96
Target Start/End: Original strand, 33214632 - 33214691
Alignment:
37 catgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctga 96  Q
    |||||||| |||||||||||||||| | ||||||||||| |||||||||| |||| ||||    
33214632 catgcttccggatctgcaacgttgaagcccaaatcattggttgaatttgtaattgactga 33214691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #55
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 33347446 - 33347553
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctgaaact 100  Q
    ||||||||||||| || | | | |||||  |||||||||||||  ||||| ||||||| || | | |||||||||||||||| |||||||| |||||  |    
33347446 caaataatatgataaattctgagtcaccgaaatacccatgctttcggatccgcaacgtcgacgcctaaatcattgattgaatctgtgattgactgaagtt 33347545  T
101 gatctttc 108  Q
    ||||||||    
33347546 gatctttc 33347553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 242 - 283
Target Start/End: Original strand, 20559901 - 20559943
Alignment:
242 atgtgaaaatcacttatttagattgaaag-aaaggggaaaaaa 283  Q
    ||||||||||||||||||||||||||||| |||||||||||||    
20559901 atgtgaaaatcacttatttagattgaaagaaaaggggaaaaaa 20559943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 242 - 283
Target Start/End: Original strand, 20571463 - 20571505
Alignment:
242 atgtgaaaatcacttatttagattgaaag-aaaggggaaaaaa 283  Q
    ||||||||||||||||||||||||||||| |||||||||||||    
20571463 atgtgaaaatcacttatttagattgaaagaaaaggggaaaaaa 20571505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 28086737 - 28086823
Alignment:
1 caaataatatgatgaaatgtaaa-tcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgt 86  Q
    ||||||||||||| |||| |||| ||||   |||||| ||| ||  ||||||||||||||||  |||||||||||||||||||||||    
28086737 caaataatatgataaaatctaaaatcactgaaataccaatgtttacggatctgcaacgttgacttccaaatcattgattgaatttgt 28086823  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 242 - 295
Target Start/End: Original strand, 31013726 - 31013780
Alignment:
242 atgtgaaaatcacttatttagattgaaag-aaaggggaaaaaagatgcagagggg 295  Q
    ||||||||| ||||||||||||||||||| ||||||| ||||||||| |||||||    
31013726 atgtgaaaaccacttatttagattgaaagaaaagggggaaaaagatgtagagggg 31013780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #60
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 253 - 295
Target Start/End: Complemental strand, 39657390 - 39657348
Alignment:
253 acttatttagattgaaagaaaggggaaaaaagatgcagagggg 295  Q
    ||||||||||||||||| ||||| |||||||||||||||||||    
39657390 acttatttagattgaaaaaaaggagaaaaaagatgcagagggg 39657348  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #61
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 243 - 296
Target Start/End: Complemental strand, 5046682 - 5046630
Alignment:
243 tgtgaaaatcacttatttagattgaaagaaaggggaaaaaagatgcagaggggc 296  Q
    ||||||||||||||||||| ||| |||||||||||| |||||||||| ||||||    
5046682 tgtgaaaatcacttatttaaattaaaagaaagggga-aaaagatgcataggggc 5046630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #62
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 241 - 291
Target Start/End: Original strand, 8443675 - 8443727
Alignment:
241 tatgtgaaaatcacttatttagattgaaagaaaggggaaa--aaagatgcaga 291  Q
    |||||| ||||||||||||||||| |||||||||||||||  |||||||||||    
8443675 tatgtggaaatcacttatttagatcgaaagaaaggggaaaagaaagatgcaga 8443727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #63
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 21 - 82
Target Start/End: Complemental strand, 8826355 - 8826294
Alignment:
21 aaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaat 82  Q
    |||||||||||| || ||||||||   || ||||||||||||| ||||||||||||||||||    
8826355 aaatcaccagaacacacatgcttccaaatatgcaacgttgatgcccaaatcattgattgaat 8826294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #64
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 143 - 204
Target Start/End: Original strand, 20227339 - 20227400
Alignment:
143 aaaatgcgaaatcaaacaacgccgcacaagaagacgaacaacacaacgtcgcactaagacga 204  Q
    |||||| |||||||||||||| |||| |||| ||||||||| |||||| |||||| ||||||    
20227339 aaaatgtgaaatcaaacaacgtcgcagaagacgacgaacaatacaacgacgcactcagacga 20227400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #65
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 245 - 295
Target Start/End: Complemental strand, 23230575 - 23230523
Alignment:
245 tgaaaatcacttatttagattgaaag--aaaggggaaaaaagatgcagagggg 295  Q
    |||||| |||||||||||||||||||  ||||||||||||||||| |||||||    
23230575 tgaaaaccacttatttagattgaaagaaaaaggggaaaaaagatgtagagggg 23230523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #66
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 82
Target Start/End: Original strand, 26469071 - 26469152
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaat 82  Q
    ||||||||||||| |||| |||||||||||||||| ||||| |   |||   ||||||||| | ||||||||||||||||||    
26469071 caaataatatgataaaatctaaatcaccagaatacacatgcattcagatgcacaacgttgacgcccaaatcattgattgaat 26469152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #67
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 241 - 294
Target Start/End: Original strand, 40619227 - 40619280
Alignment:
241 tatgtgaaaatcacttatttagattgaaagaaaggggaaaaaagatgcagaggg 294  Q
    ||||||||||||||||||||||||||| ||||| | ||||||| ||| ||||||    
40619227 tatgtgaaaatcacttatttagattgatagaaaagagaaaaaatatgtagaggg 40619280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 242 - 295
Target Start/End: Original strand, 7883395 - 7883450
Alignment:
242 atgtgaaaatcacttatttagattgaaagaaa--ggggaaaaaagatgcagagggg 295  Q
    ||||||||| ||||||||||||||||||||||   ||||||||||||| |||||||    
7883395 atgtgaaaaccacttatttagattgaaagaaaagagggaaaaaagatgtagagggg 7883450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 248 - 295
Target Start/End: Complemental strand, 8981125 - 8981077
Alignment:
248 aaatcacttatttagattgaaag-aaaggggaaaaaagatgcagagggg 295  Q
    ||||||||||||||||||||||| |||||||||||| |||||| |||||    
8981125 aaatcacttatttagattgaaagaaaaggggaaaaaggatgcatagggg 8981077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 243 - 287
Target Start/End: Original strand, 25191223 - 25191267
Alignment:
243 tgtgaaaatcacttatttagattgaaagaaaggggaaaaaagatg 287  Q
    |||||||||||||||||||  |||||||||| |||||||||||||    
25191223 tgtgaaaatcacttatttaatttgaaagaaaagggaaaaaagatg 25191267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 30 - 82
Target Start/End: Original strand, 27747051 - 27747103
Alignment:
30 gaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaat 82  Q
    |||||||||||| || |||||| ||||||||||| ||||||| ||||||||||    
27747051 gaatacccatgcatccggatctacaacgttgatgcccaaatctttgattgaat 27747103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 234 - 282
Target Start/End: Original strand, 33214779 - 33214827
Alignment:
234 cttaatgtatgtgaaaatcacttatttagattgaaagaaaggggaaaaa 282  Q
    |||||| |||| |||||||||||||||| ||||||||||| ||||||||    
33214779 cttaatatatgcgaaaatcacttatttaaattgaaagaaaagggaaaaa 33214827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #73
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 1 - 96
Target Start/End: Complemental strand, 3673605 - 3673510
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattgtctga 96  Q
    ||||||||||||| |||  ||| ||||   ||||| |||||||| |||||||||||||||| | ||||| ||||||||  |||||| |||| ||||    
3673605 caaataatatgattaaacttaagtcactgaaatactcatgcttccggatctgcaacgttgacgcccaaagcattgatttgatttgtaattgactga 3673510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #74
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 150 - 185
Target Start/End: Original strand, 9619393 - 9619428
Alignment:
150 gaaatcaaacaacgccgcacaagaagacgaacaaca 185  Q
    |||||||||||||||||||||||| |||||||||||    
9619393 gaaatcaaacaacgccgcacaagacgacgaacaaca 9619428  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #75
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 241 - 295
Target Start/End: Original strand, 9619477 - 9619529
Alignment:
241 tatgtgaaaatcacttatttagattgaaagaaaggggaaaaaagatgcagagggg 295  Q
    ||||||||||||||||||||||||||||| |||| |  ||||||||| |||||||    
9619477 tatgtgaaaatcacttatttagattgaaataaagag--aaaaagatgaagagggg 9619529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #76
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 150 - 185
Target Start/End: Complemental strand, 11464219 - 11464184
Alignment:
150 gaaatcaaacaacgccgcacaagaagacgaacaaca 185  Q
    |||||||||||||||||||||||| |||||||||||    
11464219 gaaatcaaacaacgccgcacaagacgacgaacaaca 11464184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #77
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 245 - 295
Target Start/End: Complemental strand, 28897642 - 28897591
Alignment:
245 tgaaaatcacttatttagattgaaag-aaaggggaaaaaagatgcagagggg 295  Q
    |||||| ||||||||||||||||||| |||| |||||||||||| |||||||    
28897642 tgaaaaccacttatttagattgaaagaaaagaggaaaaaagatgtagagggg 28897591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #78
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 150 - 185
Target Start/End: Original strand, 32724517 - 32724552
Alignment:
150 gaaatcaaacaacgccgcacaagaagacgaacaaca 185  Q
    |||||||||||||||||||||||| |||||||||||    
32724517 gaaatcaaacaacgccgcacaagacgacgaacaaca 32724552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #79
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 150 - 185
Target Start/End: Complemental strand, 33896130 - 33896095
Alignment:
150 gaaatcaaacaacgccgcacaagaagacgaacaaca 185  Q
    |||| |||||||||||||||||||||||||||||||    
33896130 gaaaacaaacaacgccgcacaagaagacgaacaaca 33896095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #80
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 150 - 185
Target Start/End: Original strand, 44099970 - 44100005
Alignment:
150 gaaatcaaacaacgccgcacaagaagacgaacaaca 185  Q
    |||||||||||||||||||||||| |||||||||||    
44099970 gaaatcaaacaacgccgcacaagacgacgaacaaca 44100005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #81
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 151 - 185
Target Start/End: Complemental strand, 4809011 - 4808977
Alignment:
151 aaatcaaacaacgccgcacaagaagacgaacaaca 185  Q
    ||||||||||||||||||||||| |||||||||||    
4809011 aaatcaaacaacgccgcacaagacgacgaacaaca 4808977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #82
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 249 - 287
Target Start/End: Complemental strand, 8867755 - 8867717
Alignment:
249 aatcacttatttagattgaaagaaaggggaaaaaagatg 287  Q
    |||||||||||||||||||||||||||| || |||||||    
8867755 aatcacttatttagattgaaagaaagggaaacaaagatg 8867717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #83
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 151 - 185
Target Start/End: Complemental strand, 11196936 - 11196902
Alignment:
151 aaatcaaacaacgccgcacaagaagacgaacaaca 185  Q
    ||||||||||||||||||||||| |||||||||||    
11196936 aaatcaaacaacgccgcacaagacgacgaacaaca 11196902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #84
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 241 - 283
Target Start/End: Original strand, 14545056 - 14545098
Alignment:
241 tatgtgaaaatcacttatttagattgaaagaaaggggaaaaaa 283  Q
    |||||||||| |||||||||||||||||||||| | |||||||    
14545056 tatgtgaaaaccacttatttagattgaaagaaaagagaaaaaa 14545098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #85
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 241 - 295
Target Start/End: Original strand, 24099417 - 24099471
Alignment:
241 tatgtgaaaatcacttatttagattgaaagaaaggggaaaaaagatgcagagggg 295  Q
    |||||| |||||||||||||| || ||||||||| ||||| || |||||||||||    
24099417 tatgtggaaatcacttatttaaatcgaaagaaagaggaaacaaaatgcagagggg 24099471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 151 - 185
Target Start/End: Complemental strand, 34611851 - 34611817
Alignment:
151 aaatcaaacaacgccgcacaagaagacgaacaaca 185  Q
    ||||||||||||||||||||||| |||||||||||    
34611851 aaatcaaacaacgccgcacaagacgacgaacaaca 34611817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #87
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 39646113 - 39646201
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgtgattg 91  Q
    ||||||||||||| |||| ||| |||| |||||| | ||||||| |||| ||||||||| ||| | |||||||||||||||| ||| ||||    
39646113 caaataatatgattaaatttaagtcacaagaatatc-atgcttc-ggatttgcaacgtttatgcctaaatcattgattgaatatgtaattg 39646201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #88
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 151 - 185
Target Start/End: Original strand, 43192383 - 43192417
Alignment:
151 aaatcaaacaacgccgcacaagaagacgaacaaca 185  Q
    ||||||||||||||||||||||| |||||||||||    
43192383 aaatcaaacaacgccgcacaagacgacgaacaaca 43192417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #89
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 274
Target Start/End: Complemental strand, 2655834 - 2655801
Alignment:
241 tatgtgaaaatcacttatttagattgaaagaaag 274  Q
    ||||||||||||||||||||||||||||| ||||    
2655834 tatgtgaaaatcacttatttagattgaaataaag 2655801  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #90
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 294
Target Start/End: Complemental strand, 3673379 - 3673326
Alignment:
241 tatgtgaaaatcacttatttagattgaaagaaaggggaaaaaagatgcagaggg 294  Q
    ||||||| || |||||||||||||||||||||| |||  |||||||| ||||||    
3673379 tatgtgataaccacttatttagattgaaagaaaaggggcaaaagatgtagaggg 3673326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #91
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 160 - 197
Target Start/End: Original strand, 7883314 - 7883351
Alignment:
160 aacgccgcacaagaagacgaacaacacaacgtcgcact 197  Q
    |||||||||||||| |||||||||||||||| ||||||    
7883314 aacgccgcacaagacgacgaacaacacaacgccgcact 7883351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #92
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 274
Target Start/End: Original strand, 9498721 - 9498754
Alignment:
241 tatgtgaaaatcacttatttagattgaaagaaag 274  Q
    ||||||||||||||||||||||||||||| ||||    
9498721 tatgtgaaaatcacttatttagattgaaataaag 9498754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #93
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 274
Target Start/End: Original strand, 14907043 - 14907076
Alignment:
241 tatgtgaaaatcacttatttagattgaaagaaag 274  Q
    ||||||||||||||||||||||||||||| ||||    
14907043 tatgtgaaaatcacttatttagattgaaataaag 14907076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #94
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 83
Target Start/End: Original strand, 17430804 - 17430857
Alignment:
30 gaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatt 83  Q
    ||||||||||| |||||||||| ||| |||||  ||||||||||||||| ||||    
17430804 gaatacccatgtttctggatcttcaatgttgacatccaaatcattgattcaatt 17430857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #95
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 152 - 185
Target Start/End: Complemental strand, 19876257 - 19876224
Alignment:
152 aatcaaacaacgccgcacaagaagacgaacaaca 185  Q
    |||||||||||||||||||||| |||||||||||    
19876257 aatcaaacaacgccgcacaagacgacgaacaaca 19876224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #96
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 152 - 185
Target Start/End: Complemental strand, 28239879 - 28239846
Alignment:
152 aatcaaacaacgccgcacaagaagacgaacaaca 185  Q
    |||||||||||||||||||||| |||||||||||    
28239879 aatcaaacaacgccgcacaagacgacgaacaaca 28239846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #97
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 40211227 - 40211312
Alignment:
1 caaataatatgatgaaatgtaaatcaccagaatacccatgcttctggatctgcaacgttgatgtccaaatcattgattgaatttgt 86  Q
    ||||||||||||| ||||  || ||| |  ||||| |||||||| |||||| ||||||||| | ||||||||||| | ||||||||    
40211227 caaataatatgataaaatccaagtcaacgaaatactcatgcttccggatctacaacgttgacgcccaaatcattggtggaatttgt 40211312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #98
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 258 - 294
Target Start/End: Original strand, 1236865 - 1236901
Alignment:
258 tttagattgaaagaaaggggaaaaaagatgcagaggg 294  Q
    ||||||| ||| |||||||||||||||||||||||||    
1236865 tttagatcgaacgaaaggggaaaaaagatgcagaggg 1236901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #99
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 241 - 269
Target Start/End: Complemental strand, 11196855 - 11196827
Alignment:
241 tatgtgaaaatcacttatttagattgaaa 269  Q
    |||||||||||||||||||||||||||||    
11196855 tatgtgaaaatcacttatttagattgaaa 11196827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #100
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 241 - 269
Target Start/End: Original strand, 15597285 - 15597313
Alignment:
241 tatgtgaaaatcacttatttagattgaaa 269  Q
    |||||||||||||||||||||||||||||    
15597285 tatgtgaaaatcacttatttagattgaaa 15597313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #101
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 241 - 269
Target Start/End: Complemental strand, 19876177 - 19876149
Alignment:
241 tatgtgaaaatcacttatttagattgaaa 269  Q
    |||||||||||||||||||||||||||||    
19876177 tatgtgaaaatcacttatttagattgaaa 19876149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #102
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 241 - 269
Target Start/End: Original strand, 26469351 - 26469379
Alignment:
241 tatgtgaaaatcacttatttagattgaaa 269  Q
    |||||||||||||||||||||||||||||    
26469351 tatgtgaaaatcacttatttagattgaaa 26469379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #103
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 241 - 269
Target Start/End: Original strand, 32724608 - 32724636
Alignment:
241 tatgtgaaaatcacttatttagattgaaa 269  Q
    |||||||||||||||||||||||||||||    
32724608 tatgtgaaaatcacttatttagattgaaa 32724636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #104
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 46 - 82
Target Start/End: Complemental strand, 33896212 - 33896176
Alignment:
46 ggatctgcaacgttgatgtccaaatcattgattgaat 82  Q
    |||||||||||||||| ||||||||| ||||||||||    
33896212 ggatctgcaacgttgacgtccaaatctttgattgaat 33896176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #105
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 3 - 86
Target Start/End: Complemental strand, 34609998 - 34609915
Alignment:
3 aataatatgatgaaatgtaaatcaccagaatacccatgcttctgga-tctgcaacgttgatgtccaaatcattgattgaatttgt 86  Q
    ||||||||||| |||  ||||||||| |||||| |||| |||| || ||||||||||| | | ||||||||||||||| ||||||    
34609998 aataatatgataaaacctaaatcaccggaatactcatg-ttctcgaatctgcaacgttcacgcccaaatcattgattgcatttgt 34609915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 152; Significance: 2e-80; HSPs: 85)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 14211388 - 14211188
Alig