View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_21_5 (Length: 430)

Name: 108_21_5
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_21_5
108_21_5
[»] chr8 (1 HSPs)
chr8 (1-426)||(3915844-3916265)


Alignment Details
Target: chr8 (Bit Score: 372; Significance: 0; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 372; E-Value: 0
Query Start/End: Original strand, 1 - 426
Target Start/End: Complemental strand, 3916265 - 3915844
Alignment:
1 ggaagtgtttacgaacccgaagggtatggaggttttccgttaccaccgccgccgacgtttataacttgcttgttttggtatnaactttgtttgttttggc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
3916265 ggaagtgtttacgaacccgaagggtatggaggttttccgttaccaccgccgccgacgtttataacttgcttgttttggtataaactttgtttgttttggc 3916166  T
101 ctttgttttgccctgattatcaaaagatgtgtctttattacaaagccacagaagaagaagaagctggtccaaatgctcaaagcgtggctaaatcccctaa 200  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||| ||||||||||||||||||    
3916165 ctttgttttgtcctgattatcaaaagatgtgtctttattacaaagccacagaagaagaag---ctggtccaaatgctcaaaccgtggctaaatcccctaa 3916069  T
201 tgttccatgatttcataatgttgctatatggcttgtgtgttatagatatctatatgtttgaagtgtgattctgaaagtattattataatatcaaaattaa 300  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
3916068 tgttccatgatttcataatgttgctatatggcttgtgtgttatagatatctatatgtttgaagtgtgattgtgaaagtattattataatatcaaaattaa 3915969  T
301 atatagctaattataaataacttaanaggcctccactatagttgtgtgccttacntanatttttaatttgtggcatgtatttgcatcccttgttccatgc 400  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||| || ||||||||||||||||||||||||| || |||||||||||||    
3915968 atatagctaattataaataacttaataggcctccactatagttgtgtgccttacttagatttttaatttgtggcatgtatttgtat-ccttgttccatgc 3915870  T
401 atatcactgttatatgctatgattga 426  Q
    |||||| |||||||||||||||||||    
3915869 atatcattgttatatgctatgattga 3915844  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 360377 times since January 2019
Visitors: 483