View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_21_52 (Length: 279)

Name: 108_21_52
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_21_52
108_21_52
[»] chr5 (2 HSPs)
chr5 (1-225)||(4589058-4589284)
chr5 (222-279)||(4589280-4589337)


Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 4589284 - 4589058
Alignment:
1 tgatgcacatatcaaaaaacatcttaaaagctgcca--gactatggtgattgaatgaaaggcatcctaatggaagccgccacaaactggggtgcttgact 98  Q
    ||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
4589284 tgatgcacatatcaaaaaacatcttaaaagctgccacagactatggtgattgaatgaaaggcatcctaatggaagctgccacaaactggggtgcttgact 4589185  T
99 ctaacatagatacaactttcttcacaaattgaagctacacttcttttggtttctgtgtttgcagtgagaagggtgccttttacgcaacaagcatgcttac 198  Q
    ||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
4589184 ctaacatggatacaaccttcttcacaaattgaagctacacttcttttggtttctgtgtttgcagtgagaagggtgccttttacgcaataagcatgcttac 4589085  T
199 cattccctgcttccacgcatcgcaatt 225  Q
    |||||||||||||||||||||||||||    
4589084 cattccctgcttccacgcatcgcaatt 4589058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 222 - 279
Target Start/End: Complemental strand, 4589337 - 4589280
Alignment:
222 aattcagcccttgatctgtgagtatcagacctatctgatgatgagaacgacagtgatg 279  Q
    |||||| || ||||||||||||||||||||||||||||||||||||||||||||||||    
4589337 aattcaaccattgatctgtgagtatcagacctatctgatgatgagaacgacagtgatg 4589280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106244 times since January 2019
Visitors: 1320