View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_21_57 (Length: 507)

Name: 108_21_57
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_21_57
108_21_57
[»] chr2 (2 HSPs)
chr2 (1-447)||(36457105-36457548)
chr2 (444-507)||(36457544-36457607)
[»] chr7 (1 HSPs)
chr7 (1-80)||(11629593-11629672)


Alignment Details
Target: chr2 (Bit Score: 391; Significance: 0; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 391; E-Value: 0
Query Start/End: Original strand, 1 - 447
Target Start/End: Complemental strand, 36457548 - 36457105
Alignment:
1 cgaagaatagatgttcctcgctctaattattgtcagaacagaacacaaaggatgaattatgatccgcaggcataatgtttcttgcgattaaattcaacat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
36457548 cgaagaatagatgttcctcgctctaattattgtcagaacagaacacaaaggatgaattatgatccgcaggcataatgtttcttgtgattaaattcaacat 36457449  T
101 tgactgcagcctcttctgcaggagcttccacccgaaaacctggactttcgacacatcgccaaattaggtgatatgctgctctaaactcgtcgcctgcata 200  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||    
36457448 tgactgcagcctcttctgcaggagcttccacacgaaaacctggactttcgacacatcgccaaattaggtgatatgctactttaaactcgtcgcctgcata 36457349  T
201 taaatctgacagcattctacatcagcttttgcagctgaatctctgcgtagattctagtttccagacccagtatcaggctggtcctgccttggagacgcgg 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |    
36457348 taaatctgacagcattctacatcagcttttgcagctgaatctctgtgtagactctagtttccagacccagtatcaggctggtcctgccttggagacgctg 36457249  T
301 acagcagcagcgtattcaaattctgcaccagtttaggccctcccaatcaatagcattacgcttccaagatagcctcctatgaccacccattattaatcca 400  Q
    ||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
36457248 acagcagcagcgtattcaaattctgcaccag-ttagg-cctcccaatcaatagcattacgcttccaagatagcct-ctatgaccacccattattaatcca 36457152  T
401 ctcccctatgttgctaattatttcatgtgttagtagcttgttgaatt 447  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||    
36457151 ctcccctatgttgctaattatttcatgtgttagtaccttgttgaatt 36457105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 444 - 507
Target Start/End: Complemental strand, 36457607 - 36457544
Alignment:
444 aattgatactccaatccactgataaaactccaaacaaaccactaaacttcactgacagccgaag 507  Q
    |||||| |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||    
36457607 aattgacactccaatccactgataaaactccaaccaaaccacaaaacttcactgacagccgaag 36457544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 64; Significance: 9e-28; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 9e-28
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 11629593 - 11629672
Alignment:
1 cgaagaatagatgttcctcgctctaattattgtcagaacagaacacaaaggatgaattatgatccgcaggcataatgttt 80  Q
    ||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |||||| ||||||||    
11629593 cgaagaatagatgtttctcgctctaattattgtcggaacagaacacaaaggatgaattatgatctgcaggcctaatgttt 11629672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106236 times since January 2019
Visitors: 1320