View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_6_11 (Length: 312)

Name: 108_6_11
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_6_11
108_6_11
[»] chr3 (2 HSPs)
chr3 (71-312)||(53000589-53000830)
chr3 (19-78)||(53000863-53000924)


Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 71 - 312
Target Start/End: Original strand, 53000589 - 53000830
Alignment:
71 attaattattagttttggaaaaacctttattgaccataaatcttctaagaatggaaagttacatatatgattattagaaagaaagtctcaaagtcttaaa 170  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
53000589 attaattattagttttggaaaaacctttattgaccataaatcttctaagaatggtaagttacatatatgattattagaaagaaagtctcaaagtcttaaa 53000688  T
171 tgtgaaactggactggtccatcatgttggtttatcacagtctttaaaagagactacccatgttctgtgaacgagatttgttagtatctggtaacaacagt 270  Q
    |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53000689 tgtgaaactgtactggtccatcatgttggtttatcacagtctttaaaagagactacccatgttctgtgaacgagatttgttagtatctggtaacaacagt 53000788  T
271 gaaactatctaacaaaaatgaggtatatattcaagtgaatat 312  Q
    ||||||||||||||||||||||||||||||||||||||||||    
53000789 gaaactatctaacaaaaatgaggtatatattcaagtgaatat 53000830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 53000863 - 53000924
Alignment:
19 accacggaacaaagaaagtgaccactgaccag--taatttatttcttctagctaattaatta 78  Q
    ||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||    
53000863 accacggaacaaagaaagtgaccactgaccagtataatttatttcttctagctaattaatta 53000924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110724 times since January 2019
Visitors: 1335