View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_6_25 (Length: 652)

Name: 108_6_25
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_6_25
108_6_25
[»] chr1 (6 HSPs)
chr1 (1-287)||(4678569-4678854)
chr1 (302-566)||(4678131-4678392)
chr1 (40-284)||(15594908-15595152)
chr1 (15-284)||(34466818-34467079)
chr1 (303-462)||(15595474-15595631)
chr1 (307-352)||(52549098-52549143)
[»] chr7 (44 HSPs)
chr7 (7-284)||(8659237-8659514)
chr7 (7-287)||(8654321-8654601)
chr7 (7-287)||(8667290-8667570)
chr7 (7-287)||(10494391-10494671)
chr7 (4-287)||(1301331-1301614)
chr7 (9-287)||(13333475-13333753)
chr7 (304-465)||(8654882-8655043)
chr7 (303-440)||(1301921-1302058)
chr7 (40-284)||(3147138-3147382)
chr7 (303-566)||(8659697-8659957)
chr7 (39-284)||(6789386-6789631)
chr7 (16-284)||(17260115-17260383)
chr7 (16-191)||(8545600-8545775)
chr7 (303-435)||(8585280-8585412)
chr7 (302-462)||(8667854-8668014)
chr7 (34-284)||(27830919-27831169)
chr7 (28-278)||(8646757-8647007)
chr7 (303-439)||(8628990-8629126)
chr7 (10-138)||(8585726-8585854)
chr7 (152-284)||(17267813-17267945)
chr7 (19-191)||(29577701-29577873)
chr7 (19-191)||(29581870-29582042)
chr7 (10-81)||(8628609-8628680)
chr7 (16-131)||(8636369-8636484)
chr7 (303-440)||(6789969-6790106)
chr7 (304-465)||(10493949-10494110)
chr7 (303-563)||(8647214-8647468)
chr7 (303-465)||(13333030-13333192)
chr7 (304-440)||(3147729-3147865)
chr7 (18-191)||(7877761-7877934)
chr7 (21-191)||(8570278-8570448)
chr7 (31-191)||(8382917-8383077)
chr7 (18-83)||(8590713-8590778)
chr7 (316-462)||(8671217-8671363)
chr7 (17-96)||(8559395-8559474)
chr7 (17-95)||(8602037-8602115)
chr7 (15-191)||(8576293-8576469)
chr7 (303-377)||(8582220-8582294)
chr7 (34-114)||(8609961-8610041)
chr7 (314-465)||(8640133-8640282)
chr7 (303-377)||(17268459-17268533)
chr7 (21-95)||(8581763-8581837)
chr7 (17-95)||(39985709-39985787)
chr7 (304-357)||(27830450-27830503)
[»] chr2 (16 HSPs)
chr2 (7-287)||(16657534-16657814)
chr2 (31-281)||(7542103-7542353)
chr2 (34-284)||(14703282-14703532)
chr2 (303-440)||(43625870-43626004)
chr2 (303-499)||(16657091-16657286)
chr2 (28-284)||(43625286-43625542)
chr2 (10-95)||(16662012-16662097)
chr2 (303-440)||(16661566-16661703)
chr2 (31-282)||(12245447-12245698)
chr2 (23-284)||(12234563-12234824)
chr2 (303-440)||(12235146-12235283)
chr2 (15-107)||(12258606-12258698)
chr2 (304-438)||(7542685-7542819)
chr2 (215-282)||(11999283-11999350)
chr2 (303-352)||(11999939-11999988)
chr2 (303-372)||(12258155-12258224)
[»] chr4 (6 HSPs)
chr4 (19-287)||(9335920-9336188)
chr4 (31-284)||(35132331-35132575)
chr4 (19-284)||(30775126-30775391)
chr4 (302-462)||(9335464-9335624)
chr4 (303-377)||(30775772-30775846)
chr4 (303-352)||(35132991-35133040)
[»] chr5 (3 HSPs)
chr5 (31-284)||(28219792-28220045)
chr5 (303-440)||(28220408-28220545)
chr5 (315-377)||(42555530-42555592)
[»] chr8 (3 HSPs)
chr8 (38-284)||(43744690-43744936)
chr8 (303-440)||(43745304-43745441)
chr8 (15-191)||(12528471-12528647)


Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 6)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 287
Target Start/End: Original strand, 4678569 - 4678854
Alignment:
1 aaaatcaagggtggtgtctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagagg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
4678569 aaaatcaagggtggtgtctttgaagtaaaagccactgctggaaacactcacctaggtggagaggactttgataacagaatggtgaactactttgtagagg 4678668  T
101 agttcaaaaagaagaataatgtggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgc 200  Q
    ||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
4678669 agttcaaaaagaagaataatgtggacattagtaagaacgcaaaacccttaaggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgc 4678768  T
201 ctttgtcaccactgttgaggtagattctttatttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaattaa 287  Q
    |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4678769 ctttgtcaccactgttga-gtagattctttatttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaattaa 4678854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 177; E-Value: 4e-95
Query Start/End: Original strand, 302 - 566
Target Start/End: Original strand, 4678131 - 4678392
Alignment:
302 gcagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgata 401  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||| |||||||||||||||    
4678131 gcagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccatttagggtcatcactggtgagaatgata 4678230  T
402 aaccgatgattagtgttaagtacaagggtcaagagaagccagttagtgctgacgaaatatcatccnataatccttaccaagatgagagaagttgctgaaa 501  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||| ||| |||||||||| | || |||||||| ||||||||||||||||| ||||    
4678231 aaccgatgattagtgttaagtacaagggtcaagagaagcaagttagtgttgaggaaatatcat-cgatgatccttacaaagatgagagaagttgccgaaa 4678329  T
502 cntatctaacttccctctgngaagaatgcccttgttactggtgcctgcanacttcnatgattctc 566  Q
    | |||||||||| | |||| |||||||| | |||||||| ||||||||| ||||| |||||||||    
4678330 catatctaactt-cgtctgtgaagaatgtcgttgttact-gtgcctgcatacttcaatgattctc 4678392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 61; E-Value: 7e-26
Query Start/End: Original strand, 40 - 284
Target Start/End: Complemental strand, 15595152 - 15594908
Alignment:
40 ggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaataatgtggacattagtaagaacg 139  Q
    |||||||| ||||| || |||||||||||||||||||||||||| ||||||||||   |||| ||||| | |||||| || ||||| |||| |  ||||     
15595152 ggaaacactcaccttggaggagaggactttgataacagaatggtcaactactttgcgcaggaattcaagacgaagaacaaagtggatattactgggaacc 15595053  T
140 caaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtcaccactgttgaggtagattctttatttcaggg 239  Q
    ||| | ||||  |||| ||||||||||| ||||| |||||||| |||  |||||||||  |   |||||| ||  |||||||||||| ||||||| | ||    
15595052 caagggccttgaggagattgagaactgcgtgcgaaagggcaaaaagggtactctcttttactactgtcactaccattgaggtagattgtttatttaacgg 15594953  T
240 aatagacttttcttcatctattactcgtgccaagtttgaggaaat 284  Q
     || ||||| | ||||||  |||||||| |||||||||| |||||    
15594952 tattgacttcttttcatcggttactcgttccaagtttgaagaaat 15594908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 15 - 284
Target Start/End: Original strand, 34466818 - 34467079
Alignment:
15 tgtctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaag 114  Q
    |||||||||||| || |||||| |||| ||||| ||||| ||  |||||||||||||||| ||||||| |||| |||||| | |||||||||| | ||||    
34466818 tgtctttgaagttaaggccacttctggtaacactcacctcggacgagaggactttgataatagaatggcgaaccactttgcaaaggagttcaagaggaag 34466917  T
115 aataatgtggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtcaccactg 214  Q
     |||||  ||| ||||||   ||| | |   | ||  |||||||||||||||| |||||||  ||||||||||||||||        |||||| | ||||    
34466918 cataataaggatattagtggaaaccctagagctttgaggaggttgagaactgcgtgcgagaatgcaaagaggacactct--------tttgtcgctactg 34467009  T
215 ttgaggtagattctttatttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaat 284  Q
    ||||  |||||||||||| | ||| ||| |||||   ||| || || |||||||||||||||||||||||    
34467010 ttgaaatagattctttatatgaggtaattgacttccattcgtcaatcactcgtgccaagtttgaggaaat 34467079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 303 - 462
Target Start/End: Complemental strand, 15595631 - 15595474
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgtt-gttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgata 401  Q
    ||||||||||||| |||||  |||||| || ||||||||||||| |||||||| || || | ||||||||| |||| || |||   ||||| |||||| |    
15595631 cagatgctaagagattaatcagtaggaagtttagtgattctgtttgttcaaaatgatataaagttgtggccattcaaggtcat---tggtgtgaatgaca 15595535  T
402 aaccgatgattagtgttaagtacaagggtcaagagaagccagttagtgctgacgaaatatc 462  Q
    |||| ||||||| |||||| |||||||||||||| ||||   || ||||||| ||||||||    
15595534 aacccatgattattgttaaatacaagggtcaagaaaagcgcttttgtgctgaggaaatatc 15595474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 307 - 352
Target Start/End: Original strand, 52549098 - 52549143
Alignment:
307 tgctaagaggttaattggtaggaggtatagtgattctgttgttcaa 352  Q
    |||||||||||||||||||| || || ||||||| |||||||||||    
52549098 tgctaagaggttaattggtaagaagtttagtgatcctgttgttcaa 52549143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 182; Significance: 5e-98; HSPs: 44)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 182; E-Value: 5e-98
Query Start/End: Original strand, 7 - 284
Target Start/End: Complemental strand, 8659514 - 8659237
Alignment:
7 aagggtggtgtctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttca 106  Q
    ||||||| |||||||||||||||||||||| |||||||||| ||||| || |||||||||||||||| ||||||||||||||||||||||||||||||||    
8659514 aagggtgatgtctttgaagtaaaagccacttctggaaacactcaccttggaggagaggactttgatagcagaatggtgaactactttgtagaggagttca 8659415  T
107 aaaagaagaataatgtggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgt 206  Q
    ||||||||||||| ||||||||||||   ||| ||||  ||||| ||||||||||||||||||| |||||||||||||||||||||||||| || |||||    
8659414 aaaagaagaataaagtggacattagtggtaacccaaaatccttaaggaggttgagaactgcctgtgagagggcaaagaggacactctcttttgcttttgt 8659315  T
207 caccactgttgaggtagattctttatttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaat 284  Q
    ||||||||||||||| |||||||||||||||||||||||||| | |||||  || |||||||||| ||||||||||||    
8659314 caccactgttgaggtcgattctttatttcagggaatagacttctgttcattaatcactcgtgccaggtttgaggaaat 8659237  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 161; E-Value: 2e-85
Query Start/End: Original strand, 7 - 287
Target Start/End: Complemental strand, 8654601 - 8654321
Alignment:
7 aagggtggtgtctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttca 106  Q
    ||||||| ||||||||| ||||||||||||||||||||||| |||||||| ||||| ||||||||||||||||||||| |||||||||||||||||||||    
8654601 aagggtgatgtctttgacgtaaaagccactgctggaaacacgcacctagggggagaagactttgataacagaatggtgtactactttgtagaggagttca 8654502  T
107 aaaagaagaataatgtggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgt 206  Q
    ||||||||||||| ||||| |||||    ||| ||||  ||||| ||||||||||||||||||| ||||||||||| |||| |||||||||  | |||||    
8654501 aaaagaagaataaagtggaaattagcggtaacccaaaatccttaaggaggttgagaactgcctgtgagagggcaaaaaggatactctcttttacttttgt 8654402  T
207 caccactgttgaggtagattctttatttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaattaa 287  Q
    ||||||||||||||||||| ||||||||  |||||| |||||||||||||| || |||||||| || ||||||||||||||    
8654401 caccactgttgaggtagatgctttatttatgggaatcgacttttcttcatcaatcactcgtgctaaatttgaggaaattaa 8654321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 149; E-Value: 2e-78
Query Start/End: Original strand, 7 - 287
Target Start/End: Complemental strand, 8667570 - 8667290
Alignment:
7 aagggtggtgtctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttca 106  Q
    ||||||| |||||||||||| ||||||||||| |||||||| ||||| || || |||||||| |||||||||||||||||||| ||||| |||||||| |    
8667570 aagggtgatgtctttgaagtgaaagccactgcaggaaacactcaccttgggggcgaggacttcgataacagaatggtgaactattttgttgaggagttaa 8667471  T
107 aaaagaagaataatgtggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgt 206  Q
    ||||||||||||| |||||||| ||| ||||| ||||  ||||| ||||||||||||||||||| ||||||||||| |||| ||||||||| || |||||    
8667470 aaaagaagaataaagtggacatcagtcagaacccaaaatccttaaggaggttgagaactgcctgtgagagggcaaaaaggatactctcttttgcttttgt 8667371  T
207 caccactgttgaggtagattctttatttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaattaa 287  Q
     |||||||||||||||||| ||||||||  |||||| ||||||| |||||| ||||||||||| || ||||||||| ||||    
8667370 taccactgttgaggtagatgctttatttacgggaatcgacttttgttcatcaattactcgtgctaaatttgaggaacttaa 8667290  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 145; E-Value: 5e-76
Query Start/End: Original strand, 7 - 287
Target Start/End: Original strand, 10494391 - 10494671
Alignment:
7 aagggtggtgtctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttca 106  Q
    ||||||| |||||||||||||||||||||||| || ||||| ||||| || ||||||||||| ||||||||||||||||| || ||||| ||||||||||    
10494391 aagggtgatgtctttgaagtaaaagccactgcaggtaacactcaccttgggggagaggacttcgataacagaatggtgaattattttgttgaggagttca 10494490  T
107 aaaagaagaataatgtggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgt 206  Q
    ||||||||||||| |||||||| |||  |||  ||||  ||||| ||||||||||||||||||| ||||||||||| |||| |||||||||  | |||||    
10494491 aaaagaagaataacgtggacatcagtgggaatccaaaatccttaaggaggttgagaactgcctgtgagagggcaaaaaggatactctctttttcttttgt 10494590  T
207 caccactgttgaggtagattctttatttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaattaa 287  Q
    |||||| |||||||| ||| ||||||||  |||||| |||||||||||||| || ||||||||||| ||||||||||||||    
10494591 caccaccgttgaggtcgatgctttatttatgggaatcgacttttcttcatcaatcactcgtgccaaatttgaggaaattaa 10494671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 144; E-Value: 2e-75
Query Start/End: Original strand, 4 - 287
Target Start/End: Complemental strand, 1301614 - 1301331
Alignment:
4 atcaagggtggtgtctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagt 103  Q
    |||||||| | ||||||||||||||||||||||| |||||| || ||||| || ||||||||||||||||| |||||||||| |||||||||||||||||    
1301614 atcaagggcgatgtctttgaagtaaaagccactggtggaaatactcaccttggaggagaggactttgataatagaatggtgagctactttgtagaggagt 1301515  T
104 tcaaaaagaagaataatgtggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctt 203  Q
    ||| |||||||||||| ||||||||||||   |||   ||  ||||| |||||||||||| ||| || ||||||||||| |||||||||||||| || ||    
1301514 tcagaaagaagaataaagtggacattagtggtaaccagaaatccttaaggaggttgagaattgcgtgtgagagggcaaaaaggacactctcttttgcttt 1301415  T
204 tgtcaccactgttgaggtagattctttatttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaattaa 287  Q
     |||||||| |||||||| |||||||||||||||||||| ||||| | |||||  || ||||||||||||||||||||||||||    
1301414 agtcaccaccgttgaggtcgattctttatttcagggaatcgacttctgttcattaatcactcgtgccaagtttgaggaaattaa 1301331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 135; E-Value: 5e-70
Query Start/End: Original strand, 9 - 287
Target Start/End: Original strand, 13333475 - 13333753
Alignment:
9 gggtggtgtctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaa 108  Q
    ||||| ||||||||||||||||||||| || |||||||| ||||| || ||||| ||||| |||||||||||||||||||| ||||| ||||||||||||    
13333475 gggtgatgtctttgaagtaaaagccaccgcaggaaacactcaccttgggggagaagacttcgataacagaatggtgaactattttgttgaggagttcaaa 13333574  T
109 aagaagaataatgtggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtca 208  Q
    ||||||||||| || || || |||  |||| ||||  ||||| ||||||||||||||||||| ||||||| ||| |||| |||||| ||  | |||||||    
13333575 aagaagaataacgtcgatatcagtgggaacccaaaatccttaaggaggttgagaactgcctgtgagagggaaaaaaggatactctccttttcttttgtca 13333674  T
209 ccactgttgaggtagattctttatttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaattaa 287  Q
    |||||||||| |||||| ||||||||  |||||| |||||||||||||| || ||||||||||| ||||||||||||||    
13333675 ccactgttgaagtagatgctttatttatgggaatcgacttttcttcatcaatcactcgtgccaaatttgaggaaattaa 13333753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 304 - 465
Target Start/End: Complemental strand, 8655043 - 8654882
Alignment:
304 agatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataaa 403  Q
    |||||||||||||||||||||||||| |||||||||| || |||||||||| || |||||||||||||| |||| ||  |   ||||||  ||||| |||    
8655043 agatgctaagaggttaattggtaggaagtatagtgatcctattgttcaaaaggatatcatgttgtggccattcatggttacttctggtgttaatgacaaa 8654944  T
404 ccgatgattagtgttaagtacaagggtcaagagaagccagttagtgctgacgaaatatcatc 465  Q
    || ||||||| |||||||||||| ||||||||||||| | || ||||||| |||||||||||    
8654943 cccatgattactgttaagtacaaaggtcaagagaagcaattttgtgctgaggaaatatcatc 8654882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 303 - 440
Target Start/End: Complemental strand, 1302058 - 1301921
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataa 402  Q
    ||||||||||||| ||||||||||||| || ||||||||| ||||||||||||||||| ||||||||||| |||| || |||| | |||| |||||| ||    
1302058 cagatgctaagagattaattggtaggaagtttagtgattcagttgttcaaaaagacatgatgttgtggccattcaaggtcatcgccggtgtgaatgacaa 1301959  T
403 accgatgattagtgttaagtacaagggtcaagagaagc 440  Q
    |||  |||||  |||||||||||||||||| |||||||    
1301958 acccgtgattgttgttaagtacaagggtcaggagaagc 1301921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 73; E-Value: 5e-33
Query Start/End: Original strand, 40 - 284
Target Start/End: Complemental strand, 3147382 - 3147138
Alignment:
40 ggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaataatgtggacattagtaagaacg 139  Q
    |||||||||||||| || ||||||||||||||||| || |||||||||||||||| |  |||||| || |||||||| || || ||||||||| |||||     
3147382 ggaaacacccaccttgggggagaggactttgataataggatggtgaactactttgcacgggagtttaagaagaagaacaaggtagacattagtgagaact 3147283  T
140 caaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtcaccactgttgaggtagattctttatttcaggg 239  Q
    |||   ||||| ||||||||| ||| || || || || |||||  | | ||| ||||| ||  |  |||||||  ||||| |||||||||||||||||||    
3147282 caagagccttaaggaggttgaaaacggcgtgtgaaagagcaaaacgaatactatcttttgctgtcatcaccaccattgagatagattctttatttcaggg 3147183  T
240 aatagacttttcttcatctattactcgtgccaagtttgaggaaat 284  Q
    | | ||||| | |||||| || |||||||||||||||||||||||    
3147182 atttgacttattttcatcaatcactcgtgccaagtttgaggaaat 3147138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 68; E-Value: 5e-30
Query Start/End: Original strand, 303 - 566
Target Start/End: Complemental strand, 8659957 - 8659697
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataa 402  Q
    ||||||| ||||| ||||||||||||| || ||||||||| ||||||||||||||||| ||||||||||| |||| ||  ||| |||||| ||| || ||    
8659957 cagatgcaaagagattaattggtaggaagtttagtgattcagttgttcaaaaagacatgatgttgtggccattcaaggttatcgctggtgtgaacgacaa 8659858  T
403 accgatgattagtgttaagtacaagggtcaagagaagccagttagtgctgacgaaatatcatccnataatccttaccaagatgagagaagttgctgaaac 502  Q
    ||  ||||||| |||| ||||||||||||| |||||||   || |||| || |||||||||| | ||  | ||||| || ||| |||||||||| || ||    
8659857 actcatgattaatgttcagtacaagggtcaggagaagcacttttgtgcggaggaaatatcat-ctatggtacttacaaaaatgcgagaagttgcagagac 8659759  T
503 ntatctaacttccctctgngaagaatgcccttgttactggtgcctgcanacttcnatgattctc 566  Q
     |||||||  || | ||| |||||||||  |||||||  ||||||||| | ||| |||||||||    
8659758 atatctaatgtcac-ctgtgaagaatgctgttgttac-agtgcctgcatagttcaatgattctc 8659697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 66; E-Value: 8e-29
Query Start/End: Original strand, 39 - 284
Target Start/End: Complemental strand, 6789631 - 6789386
Alignment:
39 tggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaataatgtggacattagtaagaac 138  Q
    ||||||||| ||||| || |||||||||||||||||| || |||| |||||||||| ||||||||| || | |||||| || ||||| |||| |   |||    
6789631 tggaaacactcacctcggaggagaggactttgataaccgattggtaaactactttgcagaggagtttaagaggaagaacaaagtggatattactggaaac 6789532  T
139 gcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtcaccactgttgaggtagattctttatttcagg 238  Q
     ||| | ||||| | |||||||||||||| || || ||||| || |||  ||||||||| |   | ||||| ||| |||||||||| |||||||||||||    
6789531 tcaagggccttaagaaggttgagaactgcgtgtgaaagggccaaaagggtactctcttttgttgtcgtcactactattgaggtagactctttatttcagg 6789432  T
239 gaatagacttttcttcatctattactcgtgccaagtttgaggaaat 284  Q
    | || |||||   ||||||  ||||||| |||||||||||||||||    
6789431 gcatcgacttcatttcatcacttactcgggccaagtttgaggaaat 6789386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 16 - 284
Target Start/End: Complemental strand, 17260383 - 17260115
Alignment:
16 gtctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaaga 115  Q
    ||||| ||||| || ||||| | |||| |||| || || || || |||||||||||||| ||||||||| |||| |||||||||||| ||||||  | ||    
17260383 gtcttcgaagttaaggccaccggtggagacactcatcttgggggtgaggactttgataatagaatggtgtactattttgtagaggagatcaaaagaacga 17260284  T
116 ataatgtggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtcaccactgt 215  Q
    | ||  ||||||||| |  |||| ||||  ||||| |||||||||||||||| || || |  ||||| |||||||| ||||| |||| ||| |||| |||    
17260283 aaaaattggacattattgggaacccaaaagccttaaggaggttgagaactgcatgtgaaaaagcaaaaaggacactttcttttgcctctgtgaccaatgt 17260184  T
216 tgaggtagattctttatttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaat 284  Q
    |||||||||  |||||||| ||||  |  | |||||||| || || ||||||||||||||||| |||||    
17260183 tgaggtagacgctttatttaagggtgttaatttttcttcgtcaatcactcgtgccaagtttgaagaaat 17260115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 16 - 191
Target Start/End: Complemental strand, 8545775 - 8545600
Alignment:
16 gtctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaaga 115  Q
    |||||||| || || |||||||||||| ||||  ||||||| || || ||||||||||||||||||||||| ||||||||  |||||||||| | |||||    
8545775 gtctttgatgtcaaggccactgctggagacacttacctaggcggtgaagactttgataacagaatggtgaattactttgtgaaggagttcaagaggaaga 8545676  T
116 ataatgtggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacact 191  Q
    | |||| ||| ||||||  |||| || |  ||||  ||||||||||||||||||| |||| |||||| ||||||||    
8545675 acaatgaggatattagtcggaacccagaagccttgaggaggttgagaactgcctgtgagaaggcaaaaaggacact 8545600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 303 - 435
Target Start/End: Original strand, 8585280 - 8585412
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataa 402  Q
    ||||||| ||||||||||||||||||| || ||||||| | ||||||||||| || || ||||||||||| |||| ||  ||| ||||||  ||||| ||    
8585280 cagatgccaagaggttaattggtaggaagtttagtgatcccgttgttcaaaatgatataatgttgtggccattcaaggttatctctggtgttaatgacaa 8585379  T
403 accgatgattagtgttaagtacaagggtcaaga 435  Q
    ||| ||||||| |||||||||||||||||||||    
8585380 acctatgattactgttaagtacaagggtcaaga 8585412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 302 - 462
Target Start/End: Complemental strand, 8668014 - 8667854
Alignment:
302 gcagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgata 401  Q
    |||||||||||||||||||||||||||| || ||||||  | |||||||||| ||| ||  |||||||||| |||| ||  ||  ||||||  ||||| |    
8668014 gcagatgctaagaggttaattggtaggaagtttagtgaccccgttgttcaaagagatatattgttgtggccattcaaggttatttctggtgttaatgaca 8667915  T
402 aaccgatgattagtgttaagtacaagggtcaagagaagccagttagtgctgacgaaatatc 462  Q
    |||| ||||||| ||||||||||||||||||||||||||   || ||||||| ||||||||    
8667914 aacctatgattactgttaagtacaagggtcaagagaagcacttttgtgctgaggaaatatc 8667854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 63; E-Value: 5e-27
Query Start/End: Original strand, 34 - 284
Target Start/End: Original strand, 27830919 - 27831169
Alignment:
34 actgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaataatgtggacattagta 133  Q
    |||||||||||||| ||||| |||||||||||||||||||| || ||||||||||| ||||| |||| |||||| |||||||| |  ||||||||||||     
27830919 actgctggaaacactcaccttggtggagaggactttgataataggatggtgaactattttgtggaggtgttcaagaagaagaaaagagtggacattagtg 27831018  T
134 agaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtcaccactgttgaggtagattctttatt 233  Q
     |||| |||   ||||  ||||| |||||||    || |||| |||||| ||||||||||||||  |  ||| ||| ||| ||||| ||||| | |||||    
27831019 ggaacccaagagccttgaggaggctgagaacctaatgtgagaaggcaaaaaggacactctctttttctgttgacactactattgagatagatgccttatt 27831118  T
234 tcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaat 284  Q
    | |||| || ||||| | ||||   || |||||||| ||||||||||||||    
27831119 tgagggcattgacttcttttcaatgatcactcgtgcaaagtttgaggaaat 27831169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 59; E-Value: 1e-24
Query Start/End: Original strand, 28 - 278
Target Start/End: Complemental strand, 8647007 - 8646757
Alignment:
28 aaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaataatgtggaca 127  Q
    |||||||| ||||||||||| ||||| || ||||||||||||||||  ||||||||| || |||||| | | || || || |||||||| || |||||||    
8647007 aaagccaccgctggaaacactcacctcggaggagaggactttgatagtagaatggtggaccactttgcacaagaatttaacaagaagaacaaggtggaca 8646908  T
128 ttagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtcaccactgttgaggtagattc 227  Q
    ||| |   ||| |||   ||||| ||||||||||||| || |||||||| ||||| |||||||| ||||| || | |  ||||||  ||||  |||||||    
8646907 ttactggaaactcaagagccttaaggaggttgagaacggcatgcgagagagcaaaaaggacactatcttttgcttcttgcaccaccattgaattagattc 8646808  T
228 tttatttcagggaatagacttttcttcatctattactcgtgccaagtttga 278  Q
    ||||||| | || || ||||||  |||||| || ||||||||||| |||||    
8646807 tttatttaatggcattgactttatttcatcaatcactcgtgccaaatttga 8646757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 56; E-Value: 7e-23
Query Start/End: Original strand, 303 - 439
Target Start/End: Complemental strand, 8629126 - 8628990
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataa 402  Q
    ||||||| ||||||||||||||||||| || ||||||| ||||||||||||| || |||||||| ||||| |||| ||  ||  |||||   ||||| ||    
8629126 cagatgccaagaggttaattggtaggaagtttagtgatcctgttgttcaaaaggatatcatgttctggccattcaaggttatttctggtcttaatgacaa 8629027  T
403 accgatgattagtgttaagtacaagggtcaagagaag 439  Q
     || ||||||  |||||||||||||||||||||||||    
8629026 gcctatgattgctgttaagtacaagggtcaagagaag 8628990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 10 - 138
Target Start/End: Original strand, 8585726 - 8585854
Alignment:
10 ggtggtgtctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaa 109  Q
    |||| |||||||||||| ||||| || |||||||| || ||||| || |||| ||||||||||||||||||| ||||||||||||| ||||| || || |    
8585726 ggtgatgtctttgaagttaaagcaaccgctggaaatactcaccttgggggaggggactttgataacagaatgttgaactactttgttgaggaatttaaga 8585825  T
110 agaagaataatgtggacattagtaagaac 138  Q
      ||||| |||||||| |||| |||||||    
8585826 gaaagaacaatgtggatattactaagaac 8585854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 152 - 284
Target Start/End: Complemental strand, 17267945 - 17267813
Alignment:
152 ggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtcaccactgttgaggtagattctttatttcagggaatagacttttc 251  Q
    |||||||||||||||| || || |  ||||| |||||||| |||||||||| ||| |||| ||||||||||||  |||||||| ||||  | || |||||    
17267945 ggaggttgagaactgcatgtgaaaaagcaaaaaggacactttctttcgcctctgtgaccaatgttgaggtagacgctttatttaagggtgttgatttttc 17267846  T
252 ttcatctattactcgtgccaagtttgaggaaat 284  Q
    ||| || || |||||||||||||||||||||||    
17267845 ttcgtcaatcactcgtgccaagtttgaggaaat 17267813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 19 - 191
Target Start/End: Original strand, 29577701 - 29577873
Alignment:
19 tttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaata 118  Q
    ||||||||||| |||||||||||  | || |||||||| ||||||||||| ||||| | |||||||| | |||||||  | ||||| || | |||||| |    
29577701 tttgaagtaaaggccactgctggtgatactcacctaggaggagaggacttcgataataaaatggtgagccactttgtgaatgagttgaagaggaagaaca 29577800  T
119 atgtggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacact 191  Q
    ||||||||||||||  |||| ||||  | ||| ||| | |||||||||| || ||||||||||||||| ||||    
29577801 atgtggacattagtttgaacccaaaagctttaaggaagctgagaactgcttgtgagagggcaaagagggcact 29577873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 53; E-Value: 4e-21
Query Start/End: Original strand, 19 - 191
Target Start/End: Original strand, 29581870 - 29582042
Alignment:
19 tttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaata 118  Q
    |||||||| || |||||||||||  | || |||||||| |||||||||||||||||| |||||||||| |||||||   | ||||| || | |||||| |    
29581870 tttgaagtgaaggccactgctggcgatactcacctaggaggagaggactttgataaccgaatggtgaattactttgcgaatgagttgaagaggaagaaca 29581969  T
119 atgtggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacact 191  Q
    || |||||||||||  |||| ||||  | ||| ||| | ||||||| || || ||||||||||||||||||||    
29581970 atttggacattagtgggaacccaaaagctttaaggaagctgagaacagcttgtgagagggcaaagaggacact 29582042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 10 - 81
Target Start/End: Complemental strand, 8628680 - 8628609
Alignment:
10 ggtggtgtctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatg 81  Q
    |||| |||||||||||| ||||||||||||||||| || ||||| |||||||||||||||||||||||||||    
8628680 ggtgatgtctttgaagttaaagccactgctggaaatactcaccttggtggagaggactttgataacagaatg 8628609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 16 - 131
Target Start/End: Original strand, 8636369 - 8636484
Alignment:
16 gtctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaaga 115  Q
    ||||||||||| ||||||||||| ||| |||| ||||| || ||||||||||||||||||||||||||| | || |||||||||||  |||| | |||||    
8636369 gtctttgaagttaaagccactgccggagacacacaccttggaggagaggactttgataacagaatggtggaatattttgtagaggaaatcaagaggaaga 8636468  T
116 ataatgtggacattag 131  Q
    | || || ||||||||    
8636469 acaaggtagacattag 8636484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 303 - 440
Target Start/End: Complemental strand, 6790106 - 6789969
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataa 402  Q
    ||||||||||||||||||||||||||| || ||||||||||||||||||||| || || ||||| ||||| |||| || |||  |||| |  ||||| ||    
6790106 cagatgctaagaggttaattggtaggaagtttagtgattctgttgttcaaaatgatatgatgttttggccattcaaggtcattgctggcgtcaatgacaa 6790007  T
403 accgatgattagtgttaagtacaagggtcaagagaagc 440  Q
     || ||||||  |||| |||| |||||| | |||||||    
6790006 gcccatgattgttgttgagtataagggtgaggagaagc 6789969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 304 - 465
Target Start/End: Original strand, 10493949 - 10494110
Alignment:
304 agatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataaa 403  Q
    ||||||||||||||||||||| |||| || ||||||| | ||||||||||| || || ||||||||||| |||| ||  |   | ||||  ||||| |||    
10493949 agatgctaagaggttaattggcaggaagtttagtgatccggttgttcaaaacgatataatgttgtggccattcaaggttacttcaggtgtcaatgacaaa 10494048  T
404 ccgatgattagtgttaagtacaagggtcaagagaagccagttagtgctgacgaaatatcatc 465  Q
    || |||||||  | |||||||||||||||||||||||   || |||| || |||||||||||    
10494049 cctatgattaccgctaagtacaagggtcaagagaagcacttttgtgccgaggaaatatcatc 10494110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 303 - 563
Target Start/End: Complemental strand, 8647468 - 8647214
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataa 402  Q
    ||||||||||||||||||| ||||||| || |  ||||||||||||||| || || |  | ||||||||| |||| || |||   ||| | |||||| ||    
8647468 cagatgctaagaggttaatcggtaggaagttttttgattctgttgttcagaatgataagaagttgtggccattcaaggtcat---tggggtgaatgacaa 8647372  T
403 accgatgattagtgttaagtacaagggtcaagagaagccagttagtgctgacgaaatatcatccnataatccttaccaagatgagagaagttgctgaaac 502  Q
    ||| ||||||| |||||| ||||||||| |||||||||    | ||||||| |||||||||| | || ||||| || |||||| |||| ||||| || |     
8647371 acccatgattattgttaaatacaagggtgaagagaagcgttattgtgctgaggaaatatcat-cgatgatcctcacaaagatgcgagaggttgcagagaa 8647273  T
503 ntatctaacttccctctgngaagaatgcccttgttactggtgcctgcanacttcnatgatt 563  Q
     ||| |||  |||| |||  ||||||||  |||||||| ||||||||| ||||| ||||||    
8647272 atatttaatgtccc-ctgtaaagaatgcagttgttact-gtgcctgcatacttcaatgatt 8647214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 303 - 465
Target Start/End: Original strand, 13333030 - 13333192
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataa 402  Q
    ||||||||||||||||||||||||||| || ||||||| | ||||||||||| || || ||||||||||| |||| ||  |   ||||||  || || ||    
13333030 cagatgctaagaggttaattggtaggaagtttagtgatccggttgttcaaaatgatataatgttgtggccattcaaggttacttctggtgtcaacgacaa 13333129  T
403 accgatgattagtgttaagtacaagggtcaagagaagccagttagtgctgacgaaatatcatc 465  Q
     || |||||||  | ||||| |||||||||||||||||   || |||| || |||||||||||    
13333130 gcctatgattaccgctaagtgcaagggtcaagagaagcacttttgtgccgaggaaatatcatc 13333192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 304 - 440
Target Start/End: Complemental strand, 3147865 - 3147729
Alignment:
304 agatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataaa 403  Q
    |||||| ||||||||||||||||||| || | ||||||||||||||||||| || || ||||||||||| |||| || |||    || | |||||| |||    
3147865 agatgcaaagaggttaattggtaggaagtttggtgattctgttgttcaaaatgatatgatgttgtggccattcaaggtcatttgcggagtgaatgacaaa 3147766  T
404 ccgatgattagtgttaagtacaagggtcaagagaagc 440  Q
    || ||||||   ||||||| |||||| || |||||||    
3147765 cccatgatttcggttaagtgcaagggacaggagaagc 3147729  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 18 - 191
Target Start/End: Original strand, 7877761 - 7877934
Alignment:
18 ctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaat 117  Q
    |||||| |||| ||| ||||| ||| | || ||||||||||||||||||||||||||||||||| ||||| | || ||   |||||| || | |||||||    
7877761 ctttgatgtaatagctactgccggagatactcacctaggtggagaggactttgataacagaatgttgaaccatttagtgatggagtttaagaggaagaat 7877860  T
118 aatgtggacattagtaagaacgc-aaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacact 191  Q
    || ||||||||| ||   ||| | |  ||||||| |||||||||||||||| || |||||||| || ||||||||    
7877861 aaagtggacattggtggaaacccgagggccctta-ggaggttgagaactgcatgtgagagggctaaaaggacact 7877934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 21 - 191
Target Start/End: Complemental strand, 8570448 - 8570278
Alignment:
21 tgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaataat 120  Q
    |||||| || |||||||||||| |||| ||||| || || || || ||||||||||||||| |||   |||||||  || ||||||| |||||||| ||     
8570448 tgaagtcaaggccactgctggagacactcacctgggaggtgaagattttgataacagaatgttgactcactttgtgaagaagttcaagaagaagaacaac 8570349  T
121 gtggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacact 191  Q
    | ||| ||||||| |||| ||||  ||||  ||||||| ||||| || || ||||||||||| ||||||||    
8570348 gaggatattagtaggaacccaaaagccttgaggaggttaagaacagcttgtgagagggcaaaaaggacact 8570278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 31 - 191
Target Start/End: Original strand, 8382917 - 8383077
Alignment:
31 gccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaataatgtggacatta 130  Q
    |||||||| ||| |||| || ||||| || || ||||| ||||||||||| ||||| |||||||| || |||||||| | |||| |||||  ||||||||    
8382917 gccactgccggagacactcatctaggaggtgaagacttagataacagaatcgtgaagtactttgttgacgagttcaagaggaagcataataaggacatta 8383016  T
131 gtaagaacgcaaa-gcccttatggaggttgagaactgcctgcgagagggcaaagaggacact 191  Q
    ||  |||| |||| || |||| | ||||| ||||| || |||||||||||||| ||||||||    
8383017 gtgggaacccaaaggctctta-gaaggttaagaacggcttgcgagagggcaaaaaggacact 8383077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 8590778 - 8590713
Alignment:
18 ctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggt 83  Q
    |||||| |||||||||||| | ||| | ||||||||||| ||||||||||||||||||||||||||    
8590778 ctttgatgtaaaagccacttccggagatacccacctaggaggagaggactttgataacagaatggt 8590713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 316 - 462
Target Start/End: Original strand, 8671217 - 8671363
Alignment:
316 gttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataaaccgatgattagt 415  Q
    |||||||||||||| || ||||||| | |||||||||| ||| ||  |||||||||| |||| ||  ||  ||||||  ||||| ||||| ||||||| |    
8671217 gttaattggtaggaagtttagtgatccggttgttcaaagagatatattgttgtggccattcaaggttatttctggtgttaatgacaaacctatgattact 8671316  T
416 gttaagtacaagggtcaagagaagccagttagtgctgacgaaatatc 462  Q
    || |||||| | |||| |||||||| | || ||||||| ||||||||    
8671317 gtcaagtacgaaggtctagagaagcaattttgtgctgaggaaatatc 8671363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 17 - 96
Target Start/End: Complemental strand, 8559474 - 8559395
Alignment:
17 tctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgta 96  Q
    |||||||||| || |||||| | ||| |||| ||||| || |||||||||||||||||||||||||||||  ||||||||    
8559474 tctttgaagtcaaggccacttccggagacacacacctcggaggagaggactttgataacagaatggtgaaacactttgta 8559395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 17 - 95
Target Start/End: Complemental strand, 8602115 - 8602037
Alignment:
17 tctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgt 95  Q
    |||||||||| || |||||| | ||| |||| ||||| || |||||||||||||||||| ||||||||||| |||||||    
8602115 tctttgaagtcaaggccacttccggagacacacaccttggaggagaggactttgataaccgaatggtgaaccactttgt 8602037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 15 - 191
Target Start/End: Complemental strand, 8576469 - 8576293
Alignment:
15 tgtctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaag 114  Q
    |||||| ||||| || |||||||| ||| |||| |||||||| ||  | ||||||||||||| ||||||| |  |||||||  |||||||||  || |||    
8576469 tgtcttcgaagtcaaggccactgccggagacactcacctaggaggccaagactttgataacataatggtggatcactttgttaaggagttcaggaacaag 8576370  T
115 aataatgtggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacact 191  Q
     | || | ||| |||||| ||||  ||||  ||||| |||||||||||||||| || || | |||||| ||||||||    
8576369 tacaaagaggatattagtgagaattcaaaagccttaaggaggttgagaactgcttgtgaaaaggcaaaaaggacact 8576293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 303 - 377
Target Start/End: Complemental strand, 8582294 - 8582220
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttca 377  Q
    ||||||| |||||||||||||| ||||  |||||||||||  |||||||||| || |||| ||||||||| ||||    
8582294 cagatgcaaagaggttaattggaaggaaatatagtgattccattgttcaaaaggatatcaagttgtggcccttca 8582220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 34 - 114
Target Start/End: Complemental strand, 8610041 - 8609961
Alignment:
34 actgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaag 114  Q
    ||||||||| | || ||||| || ||||||||||||||| |||||||||| ||  |||||||  |||||||||||| ||||    
8610041 actgctggagatactcaccttggaggagaggactttgatcacagaatggttaatcactttgtgaaggagttcaaaaggaag 8609961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 314 - 465
Target Start/End: Original strand, 8640133 - 8640282
Alignment:
314 aggttaattggtagga-ggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataaaccgatgatt 412  Q
    |||||||||||||||| ||| |  || ||||||||||||||| || || | ||||||||| |||| || |||   ||| | |||||| ||||| | ||||    
8640133 aggttaattggtaggaaggttttttgtttctgttgttcaaaatgatatgaagttgtggccattcaaggtcat---tggggtgaatgacaaacccacgatt 8640229  T
413 agtgttaagtacaagggtcaagagaagccagttagtgctgacgaaatatcatc 465  Q
    | |||||| ||||||||| |||||||||   || |||| || |||||||||||    
8640230 attgttaaatacaagggtgaagagaagcgtttttgtgccgaggaaatatcatc 8640282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 303 - 377
Target Start/End: Complemental strand, 17268533 - 17268459
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttca 377  Q
    |||||||||||||  |||||||||||| || ||||||| |||| || |||||||| || |||| |||||| ||||    
17268533 cagatgctaagagactaattggtaggaagtttagtgatcctgtggtccaaaaagatataatgtcgtggccattca 17268459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 21 - 95
Target Start/End: Complemental strand, 8581837 - 8581763
Alignment:
21 tgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgt 95  Q
    |||||| || |||||||||||| |||| ||||| || || || || ||||||||||||||||||||  |||||||    
8581837 tgaagtcaaggccactgctggagacactcacctgggaggggaagattttgataacagaatggtgaatcactttgt 8581763  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 17 - 95
Target Start/End: Complemental strand, 39985787 - 39985709
Alignment:
17 tctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgt 95  Q
    ||||||| || |||||||| || ||| ||||||| || || || ||||| ||||| ||||||||||||||| |||||||    
39985787 tctttgaggtgaaagccacagccggagacacccatcttggaggtgaggattttgacaacagaatggtgaaccactttgt 39985709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 304 - 357
Target Start/End: Original strand, 27830450 - 27830503
Alignment:
304 agatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaaga 357  Q
    |||||||||||||||||||||||||| ||  || |||  |||||||||||||||    
27830450 agatgctaagaggttaattggtaggaagttcagcgatgatgttgttcaaaaaga 27830503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 169; Significance: 3e-90; HSPs: 16)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 169; E-Value: 3e-90
Query Start/End: Original strand, 7 - 287
Target Start/End: Original strand, 16657534 - 16657814
Alignment:
7 aagggtggtgtctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttca 106  Q
    ||||||| ||| ||||| |||||||||||||| |||||||| ||||| || |||||||||||||||||||||| ||||||||||||||||||||||||      
16657534 aagggtgatgtttttgaggtaaaagccactgccggaaacactcaccttgggggagaggactttgataacagaacggtgaactactttgtagaggagtttc 16657633  T
107 aaaagaagaataatgtggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgt 206  Q
    ||||||||||||| |||||||| |||  |||| |||   ||||  |||||||||||||||| || |||||||||||||||||||||||||| || |||||    
16657634 aaaagaagaataaggtggacataagtgggaactcaagagccttgaggaggttgagaactgcatgtgagagggcaaagaggacactctcttttgcttttgt 16657733  T
207 caccactgttgaggtagattctttatttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaattaa 287  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||| || || |||||||||||||||||||||||    
16657734 caccactgttgaggtagattctttatttcagggaattgacttttcttcatcaatcacccgtgccaagtttgaggaaattaa 16657814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 83; E-Value: 5e-39
Query Start/End: Original strand, 31 - 281
Target Start/End: Complemental strand, 7542353 - 7542103
Alignment:
31 gccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaataatgtggacatta 130  Q
    ||||||||||| ||||| ||||| |||||||| ||||||||||| ||||||| ||||||||||||| | |||||||| |  ||||| || ||||||||||    
7542353 gccactgctggcaacactcaccttggtggagaagactttgataatagaatggcgaactactttgtacaagagttcaagagaaagaacaaagtggacatta 7542254  T
131 gtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtcaccactgttgaggtagattcttt 230  Q
    ||  |||  ||||  ||||  |||||||||||||||| || ||||||||||| ||  |||| ||||||    ||||  ||||| ||||||||||||||||    
7542253 gtgggaatccaaaagccttgaggaggttgagaactgcttgtgagagggcaaaaagatcactttctttccttgttgttgccactattgaggtagattcttt 7542154  T
231 atttcagggaatagacttttcttcatctattactcgtgccaagtttgagga 281  Q
    |||||| || || |||||||||||||| || | | | ||||||||||||||    
7542153 atttcaaggcattgacttttcttcatcgatcaatagggccaagtttgagga 7542103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 34 - 284
Target Start/End: Complemental strand, 14703532 - 14703282
Alignment:
34 actgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaataatgtggacattagta 133  Q
    |||||||||||||| ||||| || ||||||||||| ||||||||||||||||||||||||||  | |||||||| |  || || |   |||||||||||     
14703532 actgctggaaacactcacctcgggggagaggacttcgataacagaatggtgaactactttgttcaagagttcaagagaaaaaacagattggacattagtg 14703433  T
134 agaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtcaccactgttgaggtagattctttatt 233  Q
      ||  ||||  ||||| |||| |||||||| || |||||||||||||| || ||||| ||||||    ||||| ||||| ||||||||||| |||||||    
14703432 gaaatccaaaagccttaaggagcttgagaaccgcttgcgagagggcaaaaagaacactttctttccaagttgtcgccactattgaggtagatgctttatt 14703333  T
234 tcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaat 284  Q
    |||  | || |||||||||||||| || | | | ||||||||||| |||||    
14703332 tcaatgcattgacttttcttcatcgatcaatagggccaagtttgaagaaat 14703282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 66; E-Value: 8e-29
Query Start/End: Original strand, 303 - 440
Target Start/End: Complemental strand, 43626004 - 43625870
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataa 402  Q
    ||||||||||||||||||| ||||||| || ||||||||||||||||||||| || |||||||||||||| ||||||| |||   ||| | | |||| ||    
43626004 cagatgctaagaggttaatcggtaggaagtttagtgattctgttgttcaaaatgatatcatgttgtggccattcagggtcat---tggggtggatgacaa 43625908  T
403 accgatgattagtgttaagtacaagggtcaagagaagc 440  Q
    ||| ||||||| ||| || |||||||||||||||||||    
43625907 accaatgattattgtaaaatacaagggtcaagagaagc 43625870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 303 - 499
Target Start/End: Original strand, 16657091 - 16657286
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataa 402  Q
    |||||||||| |||||||| ||||||| || ||||||| ||||||||||||| || ||||| |||||||| |||| || |||  | || | |||||| ||    
16657091 cagatgctaaaaggttaatcggtaggaagtttagtgatcctgttgttcaaaatgatatcatcttgtggccattcaaggtcattgccggagtgaatgacaa 16657190  T
403 accgatgattagtgttaagtacaagggtcaagagaagccagttagtgctgacgaaatatcatccnataatccttaccaagatgagagaagttgctga 499  Q
    ||| ||||||| | || |||| |||||||||||||  | | || ||||||| |||||||||| | || |||||||| |||||| |||||||||||||    
16657191 accaatgattactcttcagtataagggtcaagagagccaattttgtgctgaggaaatatcat-ctatgatccttacaaagatgcgagaagttgctga 16657286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 28 - 284
Target Start/End: Complemental strand, 43625542 - 43625286
Alignment:
28 aaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaataatgtggaca 127  Q
    |||||||||||||||||||| ||||| || ||||||||||||||| | ||||||||||||||||||| ||| || ||  | |||||||| |||||||| |    
43625542 aaagccactgctggaaacactcaccttggaggagaggactttgatgatagaatggtgaactactttgcagaagaatttgagaagaagaacaatgtggata 43625443  T
128 ttagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtcaccactgttgaggtagattc 227  Q
    ||| |   ||| |||   || || | ||||||||||| || |||||||| | ||| |||||||| ||||| || |   ||| |||| |||||||||||||    
43625442 ttattggaaactcaagagccataagaaggttgagaacggcatgcgagagaggaaaaaggacactgtcttttgcttcgttcagcactattgaggtagattc 43625343  T
228 tttatttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaat 284  Q
    |||||| |  || || ||||| | |||||| || ||||||||||| ||||| |||||    
43625342 tttattccgtggtattgacttcttttcatcaatcactcgtgccaaatttgatgaaat 43625286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 10 - 95
Target Start/End: Original strand, 16662012 - 16662097
Alignment:
10 ggtggtgtctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgt 95  Q
    |||| |||||||||||| ||||||||| |||||||||| ||||| || |||||||||||||||||||||||| |||||||||||||    
16662012 ggtgatgtctttgaagttaaagccacttctggaaacactcacctcgggggagaggactttgataacagaatgttgaactactttgt 16662097  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 303 - 440
Target Start/End: Original strand, 16661566 - 16661703
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataa 402  Q
    |||||||||||||||||||||||||||  | ||||||  | |||||||||||||| ||  |||||||||| |||| ||  ||  ||||||  ||||| ||    
16661566 cagatgctaagaggttaattggtaggaaatttagtgaccccgttgttcaaaaagatatactgttgtggccgttcaaggttattgctggtgttaatgacaa 16661665  T
403 accgatgattagtgttaagtacaagggtcaagagaagc 440  Q
    ||| | |||||||||||||||||||||||| |||||||    
16661666 acctacgattagtgttaagtacaagggtcaggagaagc 16661703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 48; E-Value: 4e-18
Query Start/End: Original strand, 31 - 282
Target Start/End: Original strand, 12245447 - 12245698
Alignment:
31 gccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaataatgtggacatta 130  Q
    ||||||||||||||||| ||||| || |||||||| |||||||| |||||||| |||||||||| | |||||||||| |  ||||| ||  |||| ||||    
12245447 gccactgctggaaacactcaccttggaggagaggattttgataatagaatggtaaactactttgcacaggagttcaagagaaagaacaaattggatatta 12245546  T
131 gtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtcaccactgttgaggtagattcttt 230  Q
    ||   |   ||||  ||||  |||| ||||||||||| || ||||||||||| || | ||| || ||     ||||  | ||| ||||||||||||||||    
12245547 gtgcaagttcaaaagccttgaggagattgagaactgcttgtgagagggcaaaaagaatactttcgtttcttgttgttgcaactattgaggtagattcttt 12245646  T
231 atttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaa 282  Q
    |||||| || || || ||||||||||| || | ||| || ||||||||||||    
12245647 atttcaaggcattgatttttcttcatccatcaatcgggcaaagtttgaggaa 12245698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 23 - 284
Target Start/End: Complemental strand, 12234824 - 12234563
Alignment:
23 aagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaataatgt 122  Q
    |||| |||||||| || |||||||| ||||| || |||||||||||||||||||||||||| |||||| |||   | |||||||| |  ||||| || ||    
12234824 aagttaaagccacagccggaaacactcacctcgggggagaggactttgataacagaatggtaaactaccttgctcaagagttcaatagaaagaaaaaagt 12234725  T
123 ggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtcaccactgttgaggta 222  Q
    |||||| |||   ||  ||||  ||||  ||||||| |||||||| || ||||||||||| ||  || | ||||||    ||||  | ||  ||||||||    
12234724 ggacatgagtggaaatccaaaagccttgaggaggttaagaactgcttgtgagagggcaaaaagatcattgtctttccttgttgttgcaaccattgaggta 12234625  T
223 gattctttatttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaat 284  Q
    |||||||||||| | || || || ||||||||||| || | | | |||||||||||||||||    
12234624 gattctttatttgaaggcattgatttttcttcatcgatcaatagggccaagtttgaggaaat 12234563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 303 - 440
Target Start/End: Complemental strand, 12235283 - 12235146
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataa 402  Q
    ||||||||||||||||||||||||||| || |||||||   ||||||||| | ||  | ||||||||||| |||| || |    ||||||  ||||| ||    
12235283 cagatgctaagaggttaattggtaggaagtttagtgatcaagttgttcaagatgatgtgatgttgtggccattcaaggtcgctgctggtgtcaatgacaa 12235184  T
403 accgatgattagtgttaagtacaagggtcaagagaagc 440  Q
    ||| ||||||| ||| ||||||||||||| ||||||||    
12235183 acccatgattattgtcaagtacaagggtcgagagaagc 12235146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 15 - 107
Target Start/End: Original strand, 12258606 - 12258698
Alignment:
15 tgtctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaa 107  Q
    ||||||| |||| || || || ||||||||||| ||||| || ||||||||||||||||| ||||||||||  ||||||||||| ||||||||    
12258606 tgtctttcaagttaaggctacagctggaaacacgcaccttggaggagaggactttgataatagaatggtgagttactttgtagaagagttcaa 12258698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 304 - 438
Target Start/End: Complemental strand, 7542819 - 7542685
Alignment:
304 agatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataaa 403  Q
    |||||||||||||||||||||||||| || ||||||| ||||||||||| | || ||  |||| ||||| |||| ||  |   | ||||| ||||| | |    
7542819 agatgctaagaggttaattggtaggaagtttagtgatcctgttgttcaagatgatatactgttatggccattcaaggtgactgcgggtgacaatgacaga 7542720  T
404 ccgatgattagtgttaagtacaagggtcaagagaa 438  Q
    || |||||||  ||||||||||||| ||| |||||    
7542719 cccatgattaccgttaagtacaaggatcaggagaa 7542685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 215 - 282
Target Start/End: Complemental strand, 11999350 - 11999283
Alignment:
215 ttgaggtagattctttatttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaa 282  Q
    |||||||||||||||||||||| || || || ||||||||||| || | ||| || ||||||||||||    
11999350 ttgaggtagattctttatttcaaggcattgatttttcttcatccatcaatcgggcaaagtttgaggaa 11999283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 303 - 352
Target Start/End: Complemental strand, 11999988 - 11999939
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaa 352  Q
    ||||||||||||||||||||||| ||| || |||||||  ||||||||||    
11999988 cagatgctaagaggttaattggttggaagtttagtgatcttgttgttcaa 11999939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 303 - 372
Target Start/End: Original strand, 12258155 - 12258224
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggcc 372  Q
    ||||||||||||||||||||||||||| || |||||||   || |||||| | || || |||||||||||    
12258155 cagatgctaagaggttaattggtaggaagtttagtgatcaagtagttcaagatgatataatgttgtggcc 12258224  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 129; Significance: 2e-66; HSPs: 6)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 129; E-Value: 2e-66
Query Start/End: Original strand, 19 - 287
Target Start/End: Original strand, 9335920 - 9336188
Alignment:
19 tttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaata 118  Q
    ||||||||||||||||| || |||||||| ||||| || || ||||||||||||||||||||||| ||||| ||||| || ||||| |||||||||||||    
9335920 tttgaagtaaaagccaccgcaggaaacacgcaccttggaggcgaggactttgataacagaatggttaactattttgtggaagagttaaaaaagaagaata 9336019  T
119 atgtggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtcaccactgttga 218  Q
    | |||||||| |   ||||| ||||  ||||| ||||||||||||||||||| ||||||||||| |||| ||| ||||| || ||||| |||||||||||    
9336020 aagtggacatcaagcagaacccaaaatccttaaggaggttgagaactgcctgtgagagggcaaaaaggatactgtcttttgcttttgttaccactgttga 9336119  T
219 ggtagattctttatttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaattaa 287  Q
    ||||||| ||||||||  |||||| |||||||||||||| || ||||||||||| ||||||||| ||||    
9336120 ggtagatgctttatttatgggaatcgacttttcttcatcaatcactcgtgccaaatttgaggaacttaa 9336188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 66; E-Value: 8e-29
Query Start/End: Original strand, 31 - 284
Target Start/End: Complemental strand, 35132575 - 35132331
Alignment:
31 gccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaataatgtggacatta 130  Q
    |||||||| |||||||| || || |||||||||||||||||||||||||||||||||||||||||| | |||||||| |  ||||| || || |||||||    
35132575 gccactgccggaaacactcatctcggtggagaggactttgataacagaatggtgaactactttgtacaagagttcaagagaaagaacaaagtagacatta 35132476  T
131 gtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtcaccactgttgaggtagattcttt 230  Q
    ||  |||  ||||  ||         ||||||||||||||| |||||||||||||  |||| ||||||    ||||  ||| | |||| |||||||||||    
35132475 gtgggaattcaaaagcc---------ttgagaactgcctgctagagggcaaagagatcactttctttccttgttgttgccaatattgaagtagattcttt 35132385  T
231 atttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaat 284  Q
    |||||| || || || ||||||||||| || | ||| |||||||||||||||||    
35132384 atttcaaggcattgatttttcttcatcaatcaatcgcgccaagtttgaggaaat 35132331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 58; E-Value: 5e-24
Query Start/End: Original strand, 19 - 284
Target Start/End: Complemental strand, 30775391 - 30775126
Alignment:
19 tttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaata 118  Q
    |||||||| ||||| |||||||||||||| ||| | || |||||||||||||||||||||||| |||| |||||||||||||| || || | |||||| |    
30775391 tttgaagttaaagcaactgctggaaacactcacatcgggggagaggactttgataacagaatgttgaattactttgtagaggaatttaagacgaagaaca 30775292  T
119 atgtggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtcaccactgttga 218  Q
    | ||||||||||    |||  |||   | ||  |   |||||||||||| || || | |||||| ||||||||||| |||   ||| ||||   ||||||    
30775291 acgtggacattaccgggaatccaagagctttgagacagttgagaactgcatgtgaaaaggcaaaaaggacactctccttcaagtttctcacatttgttga 30775192  T
219 ggtagattctttatttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaat 284  Q
    | |||||  ||||||||| |  || |||||||||||||| || ||||||| |||||||||||||||    
30775191 gatagataatttatttcaagacattgacttttcttcatcaatcactcgtgtcaagtttgaggaaat 30775126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 52; E-Value: 2e-20
Query Start/End: Original strand, 302 - 462
Target Start/End: Original strand, 9335464 - 9335624
Alignment:
302 gcagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgata 401  Q
    |||||||||||||| |||| |||||||| || |||||||   |||||||||| ||| ||  |||||||||| |||| ||  ||  ||||||  ||||| |    
9335464 gcagatgctaagagattaactggtaggaagtttagtgatctggttgttcaaagagatatattgttgtggccattcaaggttatttctggtgttaatgaca 9335563  T
402 aaccgatgattagtgttaagtacaagggtcaagagaagccagttagtgctgacgaaatatc 462  Q
    |||| ||||||| |||||| |||||||||||||||||||   || ||||||| ||||||||    
9335564 aacctatgattactgttaactacaagggtcaagagaagcacttttgtgctgaggaaatatc 9335624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 303 - 377
Target Start/End: Complemental strand, 30775846 - 30775772
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttca 377  Q
    |||||||||| ||||||||||||||||  | ||| ||  |||||||||||||||| ||  |||||||||| ||||    
30775846 cagatgctaaaaggttaattggtaggaaatttagcgaccctgttgttcaaaaagatattttgttgtggccattca 30775772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 303 - 352
Target Start/End: Complemental strand, 35133040 - 35132991
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaa 352  Q
    |||||||||| |||||||||||||||| || ||||||| || ||||||||    
35133040 cagatgctaaaaggttaattggtaggaagtttagtgatcctattgttcaa 35132991  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 82; Significance: 2e-38; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 82; E-Value: 2e-38
Query Start/End: Original strand, 31 - 284
Target Start/End: Complemental strand, 28220045 - 28219792
Alignment:
31 gccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaataatgtggacatta 130  Q
    ||||| ||||||||||| ||||| || ||||||||||||||||  || |||||||||||||| | ||||||||| || |||||||| || ||||||||||    
28220045 gccaccgctggaaacactcacctcgggggagaggactttgatagtaggatggtgaactacttcgcagaggagtttaagaagaagaacaaggtggacatta 28219946  T
131 gtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtcaccactgttgaggtagattcttt 230  Q
     |   ||| |||   ||||| ||||||||||||| || ||| |||| ||||| |||||||| ||||| ||  ||||| ||||  ||||||||||||||||    
28219945 ctggaaactcaagagccttaaggaggttgagaacagcgtgcaagagagcaaaaaggacactatcttttgctgttgtcgccaccattgaggtagattcttt 28219846  T
231 atttcagggaatagacttttcttcatctattactcgtgccaagtttgaggaaat 284  Q
    |||| | || || || || | |||||| ||||||||||| ||||||||||||||    
28219845 atttgaaggcattgatttcttttcatcaattactcgtgctaagtttgaggaaat 28219792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 303 - 440
Target Start/End: Complemental strand, 28220545 - 28220408
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataa 402  Q
    ||||||||||||||||||||||||||| || |||||| |||||||||||| | || || | ||||||||| |||| || |||  | ||   ||| || ||    
28220545 cagatgctaagaggttaattggtaggaagtttagtgactctgttgttcaagatgatataaagttgtggccattcaaggtcatttccggaacgaacgacaa 28220446  T
403 accgatgattagtgttaagtacaagggtcaagagaagc 440  Q
    ||| ||||||  ||||||||||||||| || |||||||    
28220445 acccatgatttctgttaagtacaagggacaggagaagc 28220408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 315 - 377
Target Start/End: Original strand, 42555530 - 42555592
Alignment:
315 ggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttca 377  Q
    ||||||||||||||| || || ||||| |||||||||||| ||||| | ||||||||| ||||    
42555530 ggttaattggtaggaagtttaatgattatgttgttcaaaatgacatgaagttgtggccattca 42555592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 67; Significance: 2e-29; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 38 - 284
Target Start/End: Complemental strand, 43744936 - 43744690
Alignment:
38 ctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaagaataatgtggacattagtaagaa 137  Q
    |||||||||| ||||| || |||||||| |||||||| || |||||||||||||| | ||||||||| || |||||||| || |||||||||| |   ||    
43744936 ctggaaacactcacctcggaggagaggattttgataataggatggtgaactacttcgcagaggagtttaagaagaagaacaaggtggacattactggaaa 43744837  T
138 cgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacactctctttcgcctttgtcaccactgttgaggtagattctttatttcag 237  Q
    | |||   | ||| ||||||||||||| || ||||| || ||||| |||||| | ||||| ||  ||||||||||| |||||||||||||||||||| ||    
43744836 cccaagagcattaaggaggttgagaacagcatgcgaaagagcaaaaaggacattatcttttgctgttgtcaccactattgaggtagattctttatttgag 43744737  T
238 ggaatagacttttcttcatctattactcgtgccaagtttgaggaaat 284  Q
    || || || || | | || | || |||||| | ||||||||||||||    
43744736 ggcattgatttctttacaacaatcactcgtactaagtttgaggaaat 43744690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 303 - 440
Target Start/End: Complemental strand, 43745441 - 43745304
Alignment:
303 cagatgctaagaggttaattggtaggaggtatagtgattctgttgttcaaaaagacatcatgttgtggccnttcagggncatcnctggtgagaatgataa 402  Q
    ||||||||||||||||||||||||||| || || |||||||| ||||||||| || || | ||||||||| |||| || |||  | ||   |||||| ||    
43745441 cagatgctaagaggttaattggtaggaagtttaatgattctgatgttcaaaatgatatgaagttgtggccgttcaaggtcatttccggattgaatgacaa 43745342  T
403 accgatgattagtgttaagtacaagggtcaagagaagc 440  Q
    |||  |||||  ||||||||||||||| || |||||||    
43745341 acccgtgatttctgttaagtacaagggacaggagaagc 43745304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 15 - 191
Target Start/End: Complemental strand, 12528647 - 12528471
Alignment:
15 tgtctttgaagtaaaagccactgctggaaacacccacctaggtggagaggactttgataacagaatggtgaactactttgtagaggagttcaaaaagaag 114  Q
    |||||| ||||| || |||||||| ||| |||| ||||| || |||||||||||||||||  ||||||||||  |||||||  | ||||| || | ||||    
12528647 tgtcttcgaagtcaaggccactgccggagacactcaccttggaggagaggactttgataatcgaatggtgaatcactttgtgaaagagtttaagaggaag 12528548  T
115 aataatgtggacattagtaagaacgcaaagcccttatggaggttgagaactgcctgcgagagggcaaagaggacact 191  Q
    || || || ||||||| |  |||| ||||  || || |||| |||||||||  |||||||| ||| || ||||||||    
12528547 aacaaagttgacattattgggaactcaaaagccctaaggagattgagaactaactgcgagaaggcgaaaaggacact 12528471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111005 times since January 2019
Visitors: 1335