View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_6_51 (Length: 464)

Name: 108_6_51
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_6_51
108_6_51
[»] chr2 (3 HSPs)
chr2 (61-319)||(38747743-38748007)
chr2 (313-464)||(38747284-38747434)
chr2 (1-43)||(38747680-38747722)


Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 61 - 319
Target Start/End: Original strand, 38747743 - 38748007
Alignment:
61 tgaaccgtcattgaaattcatcccttcaaaagaacccaaaagatcaataagcatgtctctataacgaagattgttactattaatcgaagaaccatagcgt 160  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||    
38747743 tgaaccgtcattgaaattcatcccttcaaaagaacccaaaagatcaataagcatgtctctataacgaagattgttactattaattgaagaaccgtagcgt 38747842  T
161 gaaagcgatgaaacaccgtttcgtggcttcatcggagacataggtggtgatgccggaggtgaagaaaaatgagacataccaaaaagtgntgaagttggag 260  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
38747843 gaaagcgatgaaacaccgtttcgtggcttcatcggagacataggtggtgatgccggaggtgaagaaaaatgagacataccaaaaagtgttgaagttggag 38747942  T
261 aattattagc------accattaccnttaccattaccaccacagtgacaaaacnaacaacaattg 319  Q
    ||||||||||      ||||||||| ||||||||||||||||||||||||||| |||||||||||    
38747943 aattattagcaccattaccattaccgttaccattaccaccacagtgacaaaacaaacaacaattg 38748007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 313 - 464
Target Start/End: Original strand, 38747284 - 38747434
Alignment:
313 acaattgcagggataaatatgtaatatagcttaatccttcaatatttacncttcactccactgataatcaccattttggnaccatcttcaaaattccaca 412  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| |||    
38747284 acaattgcagggataaatatgtaatatagcttaatccttcaatatttacacttcactccactgataatcaccattttggcaccatcttcaaaattcaaca 38747383  T
413 ctcttctacatcagcaggttcattancccatccgagatcaggcgcaggacaa 464  Q
    |||||||||||||||| |||||||| |||||||||||||||| |||||||||    
38747384 ctcttctacatcagca-gttcattaacccatccgagatcaggggcaggacaa 38747434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 38747680 - 38747722
Alignment:
1 gttttgtatctgaagtgctttagcagcagaaacagaaacaggt 43  Q
    |||||||||||||||||||||||||||||||||||||||||||    
38747680 gttttgtatctgaagtgctttagcagcagaaacagaaacaggt 38747722  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108132 times since January 2019
Visitors: 1329