View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 108_6_51 (Length: 464)
Name: 108_6_51
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 108_6_51 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 61 - 319
Target Start/End: Original strand, 38747743 - 38748007
Alignment:
Q |
61 |
tgaaccgtcattgaaattcatcccttcaaaagaacccaaaagatcaataagcatgtctctataacgaagattgttactattaatcgaagaaccatagcgt |
160 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
T |
38747743 |
tgaaccgtcattgaaattcatcccttcaaaagaacccaaaagatcaataagcatgtctctataacgaagattgttactattaattgaagaaccgtagcgt |
38747842 |
T |
 |
Q |
161 |
gaaagcgatgaaacaccgtttcgtggcttcatcggagacataggtggtgatgccggaggtgaagaaaaatgagacataccaaaaagtgntgaagttggag |
260 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
38747843 |
gaaagcgatgaaacaccgtttcgtggcttcatcggagacataggtggtgatgccggaggtgaagaaaaatgagacataccaaaaagtgttgaagttggag |
38747942 |
T |
 |
Q |
261 |
aattattagc------accattaccnttaccattaccaccacagtgacaaaacnaacaacaattg |
319 |
Q |
|
|
|||||||||| ||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
38747943 |
aattattagcaccattaccattaccgttaccattaccaccacagtgacaaaacaaacaacaattg |
38748007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 313 - 464
Target Start/End: Original strand, 38747284 - 38747434
Alignment:
Q |
313 |
acaattgcagggataaatatgtaatatagcttaatccttcaatatttacncttcactccactgataatcaccattttggnaccatcttcaaaattccaca |
412 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| ||| |
|
|
T |
38747284 |
acaattgcagggataaatatgtaatatagcttaatccttcaatatttacacttcactccactgataatcaccattttggcaccatcttcaaaattcaaca |
38747383 |
T |
 |
Q |
413 |
ctcttctacatcagcaggttcattancccatccgagatcaggcgcaggacaa |
464 |
Q |
|
|
|||||||||||||||| |||||||| |||||||||||||||| ||||||||| |
|
|
T |
38747384 |
ctcttctacatcagca-gttcattaacccatccgagatcaggggcaggacaa |
38747434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Original strand, 38747680 - 38747722
Alignment:
Q |
1 |
gttttgtatctgaagtgctttagcagcagaaacagaaacaggt |
43 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
38747680 |
gttttgtatctgaagtgctttagcagcagaaacagaaacaggt |
38747722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Noble Research Institute, LLC
This website was viewed 108132 times since January 2019
Visitors: 1329