View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_6_52 (Length: 247)

Name: 108_6_52
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_6_52
108_6_52
[»] chr8 (1 HSPs)
chr8 (1-235)||(44370201-44370435)


Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 235
Target Start/End: Complemental strand, 44370435 - 44370201
Alignment:
1 agagattcctcgaaaagacgtgattttgacaagacattgttggaagtggttgctgtgttggaagntgaagtttcttgtttttgtttgggttgtaaataag 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
44370435 agagattcctcgaaaagacgtgattttgacaagacattgttggaagtggttgctgtgttggaagttgaagtttcttgtttttgtttgggttgtaaataag 44370336  T
101 ataattttcgggtttgtttaaatgcaacattactatcaaatgagagaacgtgtttgacttgatttgtagttgtatatattttgtggaaattagttcctag 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
44370335 ataattttcgggtttgtttaaatgcaacattactatcaaatgagagaacgtgtttgacttgatttgtagttgtatatattttgtggaaattagttcccag 44370236  T
201 tttgtagttgttcatggcacaaaacggaacaattg 235  Q
    ||||||||||||||||||||||||| |||||||||    
44370235 tttgtagttgttcatggcacaaaacagaacaattg 44370201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 201455 times since January 2019
Visitors: 1513