View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_6_60 (Length: 428)

Name: 108_6_60
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_6_60
108_6_60
[»] chr8 (2 HSPs)
chr8 (17-421)||(42917725-42918129)
chr8 (282-416)||(11166838-11166972)
[»] chr7 (2 HSPs)
chr7 (17-421)||(23254615-23255019)
chr7 (115-416)||(36913358-36913659)
[»] chr1 (1 HSPs)
chr1 (17-421)||(4755269-4755673)
[»] chr3 (3 HSPs)
chr3 (17-421)||(53535535-53535939)
chr3 (274-418)||(30460818-30460962)
chr3 (264-338)||(10328585-10328659)


Alignment Details
Target: chr8 (Bit Score: 386; Significance: 0; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 386; E-Value: 0
Query Start/End: Original strand, 17 - 421
Target Start/End: Complemental strand, 42918129 - 42917725
Alignment:
17 caattgaatatcacatttcctttgtgttgacaattcctttcttctttctaattgttcttttttcatatgtggaatcttgtagttgtgggtaccttttact 116  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42918129 caattgaatatcacatttcctttgtgttggcaattcctttcttctttctaattgttcttttttcatatgtggaatcttgtagttgtgggtaccttttact 42918030  T
117 ttcatgatttcaatcatacatgattgaagtgataaaaatatacgatttgacaggataatgtcatactcttcaaatgacttttgaactgcatccacaagat 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
42918029 ttcatgatttcaatcatacatgattgaagtgataaaaatatacgatttgacaggatagtgtcatactcttcaaatgacttttgaactgcatccacaagat 42917930  T
217 catcaacagagttaggagacttcttgtgttgtaaggcttgaactgacctaaagaaaccaagatctaaaacatttaaatcaggagagtttggtggttgacg 316  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42917929 catcaacagagttaggagacttcttgtgttgtaaggcttgaattgacctaaagaaaccaagatctaaaacatttaaatcaggagagtttggtggttgacg 42917830  T
317 caccaaacgaatatcaaatccattttgtgagnctacacgacgaaaatcttgatcttcagaatcaatgtgtgtttttgcattgtcttgttgaataaatatt 416  Q
    ||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42917829 caccaaacgaatatcaaatccattttgtgaggctacacaacgaaaatcttgatcttcagaatcaatgtgtgtttttgcattgtcttgttgaataaatatt 42917730  T
417 ggttg 421  Q
    |||||    
42917729 ggttg 42917725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 282 - 416
Target Start/End: Original strand, 11166838 - 11166972
Alignment:
282 aaaacatttaaatcaggagagtttggtggttgacgcaccaaacgaatatcaaatccattttgtgagnctacacgacgaaaatcttgatcttcagaatcaa 381  Q
    |||| ||||||||| ||||||||||  || |||| ||  |  |||||||||||||||||||||||  || | | || |||||||| ||| ||| ||  ||    
11166838 aaaatatttaaatctggagagtttgcaggctgacacattagtcgaatatcaaatccattttgtgaagctgctctacaaaaatcttcatcatcacaactaa 11166937  T
382 tgtgtgtttttgcattgtcttgttgaataaatatt 416  Q
    |||| ||| ||||||||||||||||||||||||||    
11166938 tgtgagttcttgcattgtcttgttgaataaatatt 11166972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 382; Significance: 0; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 382; E-Value: 0
Query Start/End: Original strand, 17 - 421
Target Start/End: Complemental strand, 23255019 - 23254615
Alignment:
17 caattgaatatcacatttcctttgtgttgacaattcctttcttctttctaattgttcttttttcatatgtggaatcttgtagttgtgggtaccttttact 116  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23255019 caattgaatatcacatttcctttgtgttggcaattcctttcttctttctaattgttcttttttcatatgtggaatcttgtagttgtgggtaccttttact 23254920  T
117 ttcatgatttcaatcatacatgattgaagtgataaaaatatacgatttgacaggataatgtcatactcttcaaatgacttttgaactgcatccacaagat 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
23254919 ttcatgatttcaatcatacatgattgaagtgataaaaatatacgatttgacaggatagtgtcatactcttcaaatgacttttgaactgcatccacaagat 23254820  T
217 catcaacagagttaggagacttcttgtgttgtaaggcttgaactgacctaaagaaaccaagatctaaaacatttaaatcaggagagtttggtggttgacg 316  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
23254819 catcaacagagttaggagacttcttgtgttgtaaggcttgaattgacctaaagaaaccaagatcttaaacatttaaatcaggagagtttggtggttgacg 23254720  T
317 caccaaacgaatatcaaatccattttgtgagnctacacgacgaaaatcttgatcttcagaatcaatgtgtgtttttgcattgtcttgttgaataaatatt 416  Q
    ||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23254719 caccaaacgaatatcaaatccattttgtgaggctacacaacgaaaatcttgatcttcagaatcaatgtgtgtttttgcattgtcttgttgaataaatatt 23254620  T
417 ggttg 421  Q
    |||||    
23254619 ggttg 23254615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 115 - 416
Target Start/End: Original strand, 36913358 - 36913659
Alignment:
115 ctttcatgatttcaatcatacatgattgaagtgataaaaatatacgatttgacaggataatgtcatactcttcaaatgacttttgaactgcatccacaag 214  Q
    ||||||||||||||||||||||  |||| |    |||||||||||||||||| || |  |    ||| ||||||||||| ||   ||| |||| ||||||    
36913358 ctttcatgatttcaatcatacacaattgcaaacttaaaaatatacgatttgagagcaccaccgaatattcttcaaatgatttcacaaccgcattcacaag 36913457  T
215 atcatcaacagagttaggagacttcttgtgttgtaaggcttgaactgacctaaagaaaccaagatctaaaacatttaaatcaggagagtttggtggttga 314  Q
     || |||||||| ||||| | |||||| |||||||| | |||||  |  || || || |||||||| |||| ||||||||| ||||||||||  || |||    
36913458 ctcgtcaacagatttaggtgccttcttatgttgtaaagattgaatagctctgaaaaatccaagatccaaaatatttaaatctggagagtttgcaggctga 36913557  T
315 cgcaccaaacgaatatcaaatccattttgtgagnctacacgacgaaaatcttgatcttcagaatcaatgtgtgtttttgcattgtcttgttgaataaata 414  Q
    | ||  |  |||||||||||||||||||||||  || | | || |||||||| ||| ||| ||  |||||| ||| ||||||||||||||||||||||||    
36913558 cacattagtcgaatatcaaatccattttgtgaagctgctctacaaaaatcttcatcatcacaactaatgtgagttcttgcattgtcttgttgaataaata 36913657  T
415 tt 416  Q
    ||    
36913658 tt 36913659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 382; Significance: 0; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 382; E-Value: 0
Query Start/End: Original strand, 17 - 421
Target Start/End: Complemental strand, 4755673 - 4755269
Alignment:
17 caattgaatatcacatttcctttgtgttgacaattcctttcttctttctaattgttcttttttcatatgtggaatcttgtagttgtgggtaccttttact 116  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4755673 caattgaatatcacatttcctttgtgttggcaattcctttcttctttctaattgttcttttttcatatgtggaatcttgtagttgtgggtaccttttact 4755574  T
117 ttcatgatttcaatcatacatgattgaagtgataaaaatatacgatttgacaggataatgtcatactcttcaaatgacttttgaactgcatccacaagat 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||    
4755573 ttcatgatttcaatcatacatgattgaagtgataaaaatatacgatttgacaggatagtgtcatactcttcaaatgacttttgaactgcatccacaatat 4755474  T
217 catcaacagagttaggagacttcttgtgttgtaaggcttgaactgacctaaagaaaccaagatctaaaacatttaaatcaggagagtttggtggttgacg 316  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4755473 catcaacagagttaggagacttcttgtgttgtaaggcttgaattgacctaaagaaaccaagatctaaaacatttaaatcaggagagtttggtggttgacg 4755374  T
317 caccaaacgaatatcaaatccattttgtgagnctacacgacgaaaatcttgatcttcagaatcaatgtgtgtttttgcattgtcttgttgaataaatatt 416  Q
    ||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4755373 caccaaacgaatatcaaatccattttgtgaggctacacaacgaaaatcttgatcttcagaatcaatgtgtgtttttgcattgtcttgttgaataaatatt 4755274  T
417 ggttg 421  Q
    |||||    
4755273 ggttg 4755269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 378; Significance: 0; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 378; E-Value: 0
Query Start/End: Original strand, 17 - 421
Target Start/End: Complemental strand, 53535939 - 53535535
Alignment:
17 caattgaatatcacatttcctttgtgttgacaattcctttcttctttctaattgttcttttttcatatgtggaatcttgtagttgtgggtaccttttact 116  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
53535939 caattgaatatcacatttcctttgtgttggcaattcctttcttctttctaattgttctttcttcatatgtggaatcttgtagttgtgggtaccttttact 53535840  T
117 ttcatgatttcaatcatacatgattgaagtgataaaaatatacgatttgacaggataatgtcatactcttcaaatgacttttgaactgcatccacaagat 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
53535839 ttcatgatttcaatcatacatgattgaagtgataaaaatatacgatttgacaggatagtgtcatactcttcaaatgacttttgaactgcatccacaagat 53535740  T
217 catcaacagagttaggagacttcttgtgttgtaaggcttgaactgacctaaagaaaccaagatctaaaacatttaaatcaggagagtttggtggttgacg 316  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
53535739 catcaacagagttaggagacttcttgtgttgtaaggcttgaattgacctaaagaaaccaagatcttaaacatttaaatcaggagagtttggtggttgacg 53535640  T
317 caccaaacgaatatcaaatccattttgtgagnctacacgacgaaaatcttgatcttcagaatcaatgtgtgtttttgcattgtcttgttgaataaatatt 416  Q
    ||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53535639 caccaaacgaatatcaaatccattttgtgaggctacacaacgaaaatcttgatcttcagaatcaatgtgtgtttttgcattgtcttgttgaataaatatt 53535540  T
417 ggttg 421  Q
    |||||    
53535539 ggttg 53535535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 274 - 418
Target Start/End: Original strand, 30460818 - 30460962
Alignment:
274 caagatctaaaacatttaaatcaggagagtttggtggttgacgcaccaaacgaatatcaaatccattttgtgagnctacacgacgaaaatcttgatcttc 373  Q
    |||||||||||| ||||||||| ||||| ||||  ||||||| ||  |||||||| ||||||||| ||||  |  |  | || |||||||| | ||| ||    
30460818 caagatctaaaatatttaaatctggagaatttgccggttgacacattaaacgaatgtcaaatccactttgcaatgcggctcggcgaaaatcctcatcatc 30460917  T
374 agaatcaatgtgtgtttttgcattgtcttgttgaataaatattgg 418  Q
    | ||||||| |||||| ||||||||||||||||||| ||||||||    
30460918 acaatcaatatgtgttcttgcattgtcttgttgaatgaatattgg 30460962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 264 - 338
Target Start/End: Complemental strand, 10328659 - 10328585
Alignment:
264 ctaaagaaaccaagatctaaaacatttaaatcaggagagtttggtggttgacgcaccaaacgaatatcaaatcca 338  Q
    ||||| || ||||| ||||| ||||||| ||||||||| ||||| ||||||| ||  || |||||||||||||||    
10328659 ctaaaaaacccaaggtctaagacatttagatcaggagaatttggaggttgacacattaagcgaatatcaaatcca 10328585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 313145 times since January 2019
Visitors: 446