View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_6_67 (Length: 432)

Name: 108_6_67
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_6_67
108_6_67
[»] chr1 (2 HSPs)
chr1 (104-281)||(6663731-6663908)
chr1 (13-45)||(6663640-6663672)
[»] chr8 (1 HSPs)
chr8 (278-432)||(44370202-44370350)


Alignment Details
Target: chr1 (Bit Score: 121; Significance: 8e-62; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 121; E-Value: 8e-62
Query Start/End: Original strand, 104 - 281
Target Start/End: Original strand, 6663731 - 6663908
Alignment:
104 ttagtattttgagggatgggatcaaacttcgatcttcttatcacttcaatttctaactatgttcatcttaattatcaagctaactttacatatattgtta 203  Q
    |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
6663731 ttagtattttgagggatgagatcaaacttccatcttcttatcacttcaatttctaactatgttcatcttaattatcaagctaactttatatatattgtta 6663830  T
204 aaggaannnnnnnattaaagagcnatgtactttgatttctaatttcattnnnnnnntgaatcaaaagtgttgtgaatt 281  Q
    ||||||       |||||||||| |||||||||||||||||||||||||       ||||||||||||||||||||||    
6663831 aaggaatttttttattaaagagcaatgtactttgatttctaatttcattaaaaaaatgaatcaaaagtgttgtgaatt 6663908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 13 - 45
Target Start/End: Original strand, 6663640 - 6663672
Alignment:
13 caattgtttatatgttgttgatattatgcacct 45  Q
    |||||||||||||||||||||||||||||||||    
6663640 caattgtttatatgttgttgatattatgcacct 6663672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 67; Significance: 1e-29; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 278 - 432
Target Start/End: Original strand, 44370202 - 44370350
Alignment:
278 aattgttccgttttgtgccatgaacaactacaaactaggaactaatttccacnaaaatatatacnacctacnaatcaaggtcnaacccgttcncctcatn 377  Q
    |||||||| ||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| | |||| |||||| ||| ||| |||||  |||||     
44370202 aattgttctgttttgtgccatgaacaactacaaactgggaactaatttccac-aaaatatatacaa-ctacaaatcaa-gtcaaacacgttct-ctcatt 44370297  T
378 tgataggtaatgttgcntttaaacaaccccgaaaattatccntatttncaaccca 432  Q
    ||||| |||||||||| ||||||||| |||||||||||| | ||||| |||||||    
44370298 tgata-gtaatgttgcatttaaacaaacccgaaaattat-cttatttacaaccca 44370350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 201703 times since January 2019
Visitors: 1513