View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_6_68 (Length: 211)

Name: 108_6_68
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_6_68
108_6_68
[»] chr3 (2 HSPs)
chr3 (1-211)||(42631137-42631347)
chr3 (1-211)||(42638281-42638491)


Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 42631137 - 42631347
Alignment:
1 aacccaaaagaaaaatacaaaacaaaaggaccagcaaaatcagaaccagactccttaaaatccaagaccttgccatgtttatgtttaatctgattagcta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
42631137 aacccaaaagaaaaatacaaaacaaaaggaccagcaaaatcagaaccagactccttaaaatccaagaccttgccatgtttatgtttaatctgattagcca 42631236  T
101 gtgcaccaccccatataatagatccaagaacagcaaccacactaattcccacaatccctcttttctttctactcttgaaactgaaatccattgtgtaacc 200  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42631237 atgcaccaccccatataatagatccaagaacagcaaccacactaattcccacaatccctcttttctttctactcttgaaactgaaatccattgtgtaacc 42631336  T
201 aatcccaattg 211  Q
    |||||||||||    
42631337 aatcccaattg 42631347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 42638281 - 42638491
Alignment:
1 aacccaaaagaaaaatacaaaacaaaaggaccagcaaaatcagaaccagactccttaaaatccaagaccttgccatgtttatgtttaatctgattagcta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
42638281 aacccaaaagaaaaatacaaaacaaaaggaccagcaaaatcagaaccagactccttaaaatccaagaccttgccatgtttatgtttaatctgattagcca 42638380  T
101 gtgcaccaccccatataatagatccaagaacagcaaccacactaattcccacaatccctcttttctttctactcttgaaactgaaatccattgtgtaacc 200  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42638381 atgcaccaccccatataatagatccaagaacagcaaccacactaattcccacaatccctcttttctttctactcttgaaactgaaatccattgtgtaacc 42638480  T
201 aatcccaattg 211  Q
    |||||||||||    
42638481 aatcccaattg 42638491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 315452 times since January 2019
Visitors: 447