View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_6_75 (Length: 424)

Name: 108_6_75
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_6_75
108_6_75
[»] chr3 (2 HSPs)
chr3 (219-414)||(52229969-52230163)
chr3 (1-132)||(52229751-52229882)


Alignment Details
Target: chr3 (Bit Score: 146; Significance: 9e-77; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 146; E-Value: 9e-77
Query Start/End: Original strand, 219 - 414
Target Start/End: Original strand, 52229969 - 52230163
Alignment:
219 agtcaaagaaatttcagaatctgtgttttttagtcaaattaanttcaggatcaaagacnccncaattaatcaactactagtncgttcattttttcagtgt 318  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| || ||||||||||||||||||| ||||||||||||||||||    
52229969 agtcaaagaaatttcagaatctgtgttttttagtcaaattaatttcagaatcaaagactcctcaattaatcaactactagttcgttcattttttcagtgt 52230068  T
319 tatcngtgtcttgttttncaagagcgaaatattcttgcngctntgtccaacttnaggtaggtgtcctagtatgttcnatccatccaattatgccac 414  Q
    |||| |||||||||||| |||||| ||||||||||||| ||| ||||||| || |||||||||| ||||||||||| |||||||||||||||||||    
52230069 tatctgtgtcttgtttttcaagagtgaaatattcttgctgctttgtccaatttaaggtaggtgt-ctagtatgttctatccatccaattatgccac 52230163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 1 - 132
Target Start/End: Original strand, 52229751 - 52229882
Alignment:
1 gatggcaccacttatcgcaaggtacttttacttccttctcactcttttgagatcttgtttttcttcttcttaattcatgattttgtatcttcatttttac 100  Q
    ||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52229751 gatggcaccacttatcgcagggtaattttacttccttctcactcttttgagatcttgtttttcttcttcttaattcatgattttgtatcttcatttttac 52229850  T
101 tgttggattcaaatcttgctataattggttcg 132  Q
    ||||||||||||||||||||||||||||||||    
52229851 tgttggattcaaatcttgctataattggttcg 52229882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361930 times since January 2019
Visitors: 488