View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_6_8 (Length: 298)

Name: 108_6_8
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_6_8
108_6_8
[»] chr2 (12 HSPs)
chr2 (132-298)||(40520161-40520326)
chr2 (218-298)||(40495954-40496034)
chr2 (53-130)||(40517963-40518040)
chr2 (1-47)||(40520322-40520368)
chr2 (53-130)||(40495385-40495461)
chr2 (67-154)||(3849843-3849927)
chr2 (1-41)||(40496030-40496070)
chr2 (70-120)||(33853027-33853077)
chr2 (88-147)||(6644595-6644652)
chr2 (125-166)||(40495855-40495896)
chr2 (88-154)||(6647236-6647300)
chr2 (88-154)||(42080844-42080910)
[»] chr5 (5 HSPs)
chr5 (88-154)||(11078392-11078456)
chr5 (66-108)||(29390889-29390931)
chr5 (95-154)||(12499265-12499322)
chr5 (88-154)||(34402112-34402174)
chr5 (88-154)||(37272673-37272735)
[»] chr1 (6 HSPs)
chr1 (88-154)||(30303044-30303108)
chr1 (88-154)||(52404522-52404586)
chr1 (88-154)||(52407334-52407398)
chr1 (88-146)||(5328808-5328864)
chr1 (89-152)||(12768161-12768224)
chr1 (88-147)||(33006484-33006541)
[»] scaffold0259 (1 HSPs)
scaffold0259 (88-154)||(6109-6173)
[»] chr8 (3 HSPs)
chr8 (88-154)||(18089469-18089533)
chr8 (88-154)||(40618449-40618513)
chr8 (95-154)||(17853386-17853443)
[»] chr7 (4 HSPs)
chr7 (88-146)||(8391498-8391554)
chr7 (88-154)||(46936267-46936331)
chr7 (88-120)||(10934227-10934259)
chr7 (70-102)||(10934271-10934303)
[»] chr6 (2 HSPs)
chr6 (88-154)||(15287507-15287571)
chr6 (95-154)||(14103836-14103893)
[»] chr4 (2 HSPs)
chr4 (88-154)||(13861883-13861947)
chr4 (67-107)||(50496198-50496238)
[»] chr3 (6 HSPs)
chr3 (88-154)||(22428974-22429038)
chr3 (88-154)||(53778405-53778469)
chr3 (66-108)||(36465712-36465754)
chr3 (95-154)||(27320904-27320961)
chr3 (66-106)||(36471735-36471775)
chr3 (66-102)||(47911074-47911110)


Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 12)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 132 - 298
Target Start/End: Original strand, 40520161 - 40520326
Alignment:
132 gttacattttgattggctgatatgtgtaatataaggnnnnnnntgcaatttatttaaacaatcggaggctttttataagnnnnnnntgcaaattatctgc 231  Q
    |||||||||||||||||||||||||||||||||||        ||||||||||||||||||||||||||||||||||||       ||||||||||||||    
40520161 gttacattttgattggctgatatgtgtaatataag-aaaaaaatgcaatttatttaaacaatcggaggctttttataagaaaaaaatgcaaattatctgc 40520259  T
232 tcaaagacgatctttacatgaaatcaaaatgatatatcaattgccagccatttacaaaagttgtttg 298  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40520260 tcaaagacgatctttacatgaaatcaaaatgatatatcaattgccagccatttacaaaagttgtttg 40520326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 218 - 298
Target Start/End: Original strand, 40495954 - 40496034
Alignment:
218 tgcaaattatctgctcaaagacgatctttacatgaaatcaaaatgatatatcaattgccagccatttacaaaagttgtttg 298  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40495954 tgcaaattatctgctcaaagacgatctttacatgaaatcaaaatgatatatcaattgccagccatttacaaaagttgtttg 40496034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 53 - 130
Target Start/End: Original strand, 40517963 - 40518040
Alignment:
53 accacctagatataattaaaagttaccttaagattaaaattgactcttttatttaacatttaatgttgtctatttata 130  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |||||||| |||||||||    
40517963 accacctagatataattaaaagttatcttaagattaaaattgactcttttatttgacatctaatgttgcctatttata 40518040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 40520322 - 40520368
Alignment:
1 gtttgaatcagtggctggaaagaaaagtgaagaaagtgtaattaatc 47  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
40520322 gtttgaatcagtggctggaaagaaaagtgaagaaagtgtaattaatc 40520368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 53 - 130
Target Start/End: Original strand, 40495385 - 40495461
Alignment:
53 accacctagatataattaaaagttaccttaagattaaaattgactcttttatttaacatttaatgttgtctatttata 130  Q
    ||||||| |||||||||||| ||||||||| ||||||| ||||||||||||||| |||||| |||||| |||||||||    
40495385 accacctggatataattaaaggttaccttaggattaaa-ttgactcttttatttgacatttcatgttgcctatttata 40495461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 67 - 154
Target Start/End: Complemental strand, 3849927 - 3849843
Alignment:
67 attaaaagttaccttaagattaaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    ||||||||||||||||  | |||||||||||| |||| |||||||||||||||||| || ||||  ||||||||||||||| ||||||    
3849927 attaaaagttaccttataaataaaattgactcattta-ttaacatttaatgttgtcaatgtata--ttacattttgattggttgatat 3849843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 40496030 - 40496070
Alignment:
1 gtttgaatcagtggctggaaagaaaagtgaagaaagtgtaa 41  Q
    |||||||||||||||||||||||||||||||||||||||||    
40496030 gtttgaatcagtggctggaaagaaaagtgaagaaagtgtaa 40496070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 70 - 120
Target Start/End: Complemental strand, 33853077 - 33853027
Alignment:
70 aaaagttaccttaagattaaaattgactcttttatttaacatttaatgttg 120  Q
    |||| |||||||||||||||||||||||| |||||||||| ||||||||||    
33853077 aaaatttaccttaagattaaaattgactcatttatttaacttttaatgttg 33853027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 88 - 147
Target Start/End: Complemental strand, 6644652 - 6644595
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattgg 147  Q
    ||||||||||| ||||||| |||||||||||||||||| ||||  |||||||||||||||    
6644652 aaaattgactcatttatttgacatttaatgttgtctatgtata--ttacattttgattgg 6644595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 125 - 166
Target Start/End: Original strand, 40495855 - 40495896
Alignment:
125 tttatacgttacattttgattggctgatatgtgtaatataag 166  Q
    |||||| |||||||||||||||||||| ||||||||||||||    
40495855 tttatatgttacattttgattggctgaaatgtgtaatataag 40495896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 6647236 - 6647300
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    ||||||||||| ||||||| ||||||||| ||||| || ||||  ||||||||||||||| ||||||    
6647236 aaaattgactcatttatttgacatttaatattgtcaatatata--ttacattttgattggttgatat 6647300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 42080844 - 42080910
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    |||||| |||| ||||||| ||||||||||||| |||| | ||  ||||||||||||||| ||||||    
42080844 aaaatttactcatttatttgacatttaatgttgcctatatgtatattacattttgattggttgatat 42080910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 11078392 - 11078456
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    ||||||||||| ||||||| ||||||||||||||| || ||||  ||||||||||||||| ||||||    
11078392 aaaattgactcatttatttgacatttaatgttgtcaatgtata--ttacattttgattggttgatat 11078456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 66 - 108
Target Start/End: Original strand, 29390889 - 29390931
Alignment:
66 aattaaaagttaccttaagattaaaattgactcttttatttaa 108  Q
    ||||||||||||||||| |||||||||||| | ||||||||||    
29390889 aattaaaagttaccttaggattaaaattgattattttatttaa 29390931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 95 - 154
Target Start/End: Complemental strand, 12499322 - 12499265
Alignment:
95 actcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    |||| ||||||||||||||||||||  |||| ||||  ||||||||||||||| ||||||    
12499322 actcatttatttaacatttaatgttacctatgtata--ttacattttgattggttgatat 12499265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 34402112 - 34402174
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    ||||||||||| |||||  |||||||||||||||| || ||||  ||||||||||||||| ||||||    
34402112 aaaattgactcatttat--aacatttaatgttgtcaatgtata--ttacattttgattggttgatat 34402174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 37272673 - 37272735
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    ||||||||||| |||||   ||||||||||||||| || ||||  ||||||||||||||||||||||    
37272673 aaaattgactcatttatg--acatttaatgttgtcaatgtata--ttacattttgattggctgatat 37272735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000003; HSPs: 6)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 30303044 - 30303108
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    ||||||||||| ||||||| ||||||||||||| |||| ||||  ||||||||||||||| ||||||    
30303044 aaaattgactcatttatttgacatttaatgttgcctatgtata--ttacattttgattggttgatat 30303108  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 88 - 154
Target Start/End: Complemental strand, 52404586 - 52404522
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    ||||||||||| ||||||| |||||||||||||||||| ||||  ||| ||||||||||| ||||||    
52404586 aaaattgactcatttatttgacatttaatgttgtctatatata--ttatattttgattggttgatat 52404522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 52407334 - 52407398
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    ||||||||||| ||||||| ||||||||||||||| || ||||  ||||||||||||||| ||||||    
52407334 aaaattgactcatttatttgacatttaatgttgtcaatgtata--ttacattttgattggttgatat 52407398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 88 - 146
Target Start/End: Original strand, 5328808 - 5328864
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattg 146  Q
    ||||||||||| ||||||| ||||||||||||||| || ||||  ||||||||||||||    
5328808 aaaattgactcatttatttgacatttaatgttgtcaatgtata--ttacattttgattg 5328864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 89 - 152
Target Start/End: Complemental strand, 12768224 - 12768161
Alignment:
89 aaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgat 152  Q
    |||||||||| ||||||| ||||||||||||| |||  | || |||||||||||||||| ||||    
12768224 aaattgactcatttatttgacatttaatgttgcctacgtgtatgttacattttgattggttgat 12768161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 88 - 147
Target Start/End: Original strand, 33006484 - 33006541
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattgg 147  Q
    |||||||| || ||||||| |||||||||||||||||| ||||  |||| ||||||||||    
33006484 aaaattgattcatttatttgacatttaatgttgtctatgtata--ttactttttgattgg 33006541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0259 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0259
Description:

Target: scaffold0259; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 6109 - 6173
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    ||||||||||| ||||||| ||||||||||||| |||| ||||  ||| ||||||||||| ||||||    
6109 aaaattgactcatttatttgacatttaatgttgcctatgtata--ttaaattttgattggttgatat 6173  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 18089469 - 18089533
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    ||||||||||| ||||||| |||||||||||||||||| ||||  ||| ||||| ||||| ||||||    
18089469 aaaattgactcatttatttgacatttaatgttgtctatgtata--ttatattttaattggttgatat 18089533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 40618449 - 40618513
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    ||||||||||| ||||||| ||||||||||||||| || ||||  |||||| |||||||| ||||||    
40618449 aaaattgactcatttatttgacatttaatgttgtcaatgtata--ttacatgttgattggttgatat 40618513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 95 - 154
Target Start/End: Original strand, 17853386 - 17853443
Alignment:
95 actcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    |||| ||||||| |||||||||||| ||||| ||||  ||||||||||||||| ||||||    
17853386 actcatttatttgacatttaatgttatctatgtata--ttacattttgattggttgatat 17853443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 88 - 146
Target Start/End: Complemental strand, 8391554 - 8391498
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattg 146  Q
    ||||||||||| ||||||| ||||||||||||||| || |||  |||||||||||||||    
8391554 aaaattgactcatttatttgacatttaatgttgtcaatgtat--gttacattttgattg 8391498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 46936267 - 46936331
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    ||||||||||| ||||||||||||||||| |||| ||| ||||  ||| ||||||||||| ||||||    
46936267 aaaattgactcatttatttaacatttaatattgtttatgtata--ttagattttgattggttgatat 46936331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 88 - 120
Target Start/End: Complemental strand, 10934259 - 10934227
Alignment:
88 aaaattgactcttttatttaacatttaatgttg 120  Q
    ||||||||||||||||||||||||| |||||||    
10934259 aaaattgactcttttatttaacattcaatgttg 10934227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 70 - 102
Target Start/End: Complemental strand, 10934303 - 10934271
Alignment:
70 aaaagttaccttaagattaaaattgactctttt 102  Q
    ||||||||||||||||||| |||||||||||||    
10934303 aaaagttaccttaagattagaattgactctttt 10934271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 88 - 154
Target Start/End: Complemental strand, 15287571 - 15287507
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    ||||||||||| ||||||| |||||||||||| || || ||||  ||||||||||||||| ||||||    
15287571 aaaattgactcatttatttgacatttaatgttatcaatgtata--ttacattttgattggttgatat 15287507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 95 - 154
Target Start/End: Complemental strand, 14103893 - 14103836
Alignment:
95 actcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    |||| ||||||| |||||||||||| ||||| ||||  ||||||||||||||| ||||||    
14103893 actcatttatttgacatttaatgttatctatgtata--ttacattttgattggttgatat 14103836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 13861883 - 13861947
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    ||||||||||| ||||||| | ||||||||||||| || ||||  ||||||||||||||| ||||||    
13861883 aaaattgactcatttatttgatatttaatgttgtcaatgtata--ttacattttgattggttgatat 13861947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 67 - 107
Target Start/End: Original strand, 50496198 - 50496238
Alignment:
67 attaaaagttaccttaagattaaaattgactcttttattta 107  Q
    |||||||||||||| | |||||||||| |||||||||||||    
50496198 attaaaagttacctaatgattaaaattaactcttttattta 50496238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000007; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 22428974 - 22429038
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    |||||||| || ||||||| ||||||||||||| |||| ||||  ||||||||||||||| ||||||    
22428974 aaaattgattcatttatttgacatttaatgttgcctatgtata--ttacattttgattggttgatat 22429038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 88 - 154
Target Start/End: Original strand, 53778405 - 53778469
Alignment:
88 aaaattgactcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    |||||||| || ||||||| ||||||||| |||||||| ||||  ||||||||||||||| ||||||    
53778405 aaaattgattcatttatttgacatttaatattgtctatgtata--ttacattttgattggttgatat 53778469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 66 - 108
Target Start/End: Complemental strand, 36465754 - 36465712
Alignment:
66 aattaaaagttaccttaagattaaaattgactcttttatttaa 108  Q
    ||||||||||||||||| |||||||||||| | ||||||||||    
36465754 aattaaaagttaccttaggattaaaattgatttttttatttaa 36465712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 95 - 154
Target Start/End: Complemental strand, 27320961 - 27320904
Alignment:
95 actcttttatttaacatttaatgttgtctatttatacgttacattttgattggctgatat 154  Q
    |||| ||||||| |||||||||||| ||||| ||||  ||||||||||||||| ||||||    
27320961 actcatttatttgacatttaatgttatctatgtata--ttacattttgattggttgatat 27320904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 66 - 106
Target Start/End: Original strand, 36471735 - 36471775
Alignment:
66 aattaaaagttaccttaagattaaaattgactcttttattt 106  Q
    ||||||||||||||||| |||||||||||| | ||||||||    
36471735 aattaaaagttaccttaggattaaaattgatttttttattt 36471775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 66 - 102
Target Start/End: Complemental strand, 47911110 - 47911074
Alignment:
66 aattaaaagttaccttaagattaaaattgactctttt 102  Q
    ||||||||||||||||||||||| |||||| ||||||    
47911110 aattaaaagttaccttaagattataattgattctttt 47911074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 111044 times since January 2019
Visitors: 1335