View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_6_82 (Length: 432)

Name: 108_6_82
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_6_82
108_6_82
[»] chr4 (24 HSPs)
chr4 (1-361)||(41480313-41480685)
chr4 (149-226)||(41488972-41489049)
chr4 (360-432)||(20166307-20166379)
chr4 (363-431)||(49039478-49039546)
chr4 (363-431)||(54854212-54854280)
chr4 (1-60)||(41489728-41489787)
chr4 (363-429)||(41492533-41492599)
chr4 (363-431)||(36008268-36008337)
chr4 (363-431)||(53815689-53815758)
chr4 (376-424)||(20610746-20610794)
chr4 (366-432)||(27921893-27921959)
chr4 (363-424)||(48512192-48512254)
chr4 (363-431)||(28520764-28520833)
chr4 (379-432)||(37997878-37997931)
chr4 (363-431)||(29785144-29785212)
chr4 (379-430)||(4419720-4419771)
chr4 (360-431)||(36257685-36257756)
chr4 (363-410)||(38657534-38657581)
chr4 (380-430)||(15853833-15853883)
chr4 (361-431)||(49319385-49319455)
chr4 (363-431)||(9692955-9693024)
chr4 (363-431)||(14149786-14149855)
chr4 (379-424)||(42432018-42432063)
chr4 (363-431)||(48968243-48968312)
[»] scaffold0168 (1 HSPs)
scaffold0168 (363-424)||(34073-34134)
[»] chr6 (16 HSPs)
chr6 (363-424)||(34524869-34524930)
chr6 (378-430)||(8253624-8253676)
chr6 (363-431)||(10455736-10455804)
chr6 (363-429)||(2945589-2945656)
chr6 (363-429)||(4844137-4844203)
chr6 (363-432)||(9064859-9064929)
chr6 (379-424)||(20858423-20858468)
chr6 (363-432)||(26669691-26669760)
chr6 (363-430)||(14981736-14981804)
chr6 (363-431)||(30833011-30833079)
chr6 (363-410)||(9031760-9031807)
chr6 (376-410)||(8309171-8309205)
chr6 (362-432)||(25064701-25064771)
chr6 (363-431)||(3448345-3448414)
chr6 (363-424)||(8175990-8176051)
chr6 (363-423)||(2955145-2955205)
[»] chr1 (27 HSPs)
chr1 (363-424)||(18003810-18003871)
chr1 (363-431)||(9768842-9768910)
chr1 (363-431)||(52961115-52961183)
chr1 (363-430)||(7906360-7906427)
chr1 (363-431)||(17350054-17350123)
chr1 (363-424)||(42908765-42908826)
chr1 (376-431)||(16182816-16182871)
chr1 (363-432)||(18179322-18179391)
chr1 (363-432)||(33176135-33176204)
chr1 (376-429)||(50575908-50575961)
chr1 (379-431)||(50199509-50199561)
chr1 (376-431)||(3341769-3341824)
chr1 (362-424)||(195037-195099)
chr1 (366-424)||(7015727-7015785)
chr1 (376-430)||(19536724-19536778)
chr1 (363-424)||(40678816-40678878)
chr1 (366-431)||(52833139-52833205)
chr1 (363-431)||(2052715-2052784)
chr1 (376-409)||(5862135-5862168)
chr1 (363-415)||(9527419-9527472)
chr1 (363-431)||(19976585-19976654)
chr1 (363-431)||(29491463-29491532)
chr1 (363-431)||(39238709-39238778)
chr1 (363-432)||(42801873-42801942)
chr1 (376-429)||(43020618-43020671)
chr1 (363-431)||(1721134-1721202)
chr1 (360-432)||(9931078-9931150)
[»] chr3 (21 HSPs)
chr3 (363-423)||(40160729-40160789)
chr3 (363-429)||(16874225-16874291)
chr3 (363-432)||(43774178-43774248)
chr3 (363-432)||(19137613-19137682)
chr3 (376-431)||(2903715-2903770)
chr3 (363-431)||(9624976-9625045)
chr3 (363-431)||(14868678-14868747)
chr3 (363-431)||(27183714-27183783)
chr3 (367-420)||(30745775-30745828)
chr3 (379-432)||(34407122-34407175)
chr3 (363-431)||(47191366-47191435)
chr3 (363-415)||(12236593-12236645)
chr3 (370-410)||(51017791-51017831)
chr3 (379-430)||(31108794-31108845)
chr3 (376-410)||(12143461-12143495)
chr3 (367-416)||(3973300-3973349)
chr3 (367-416)||(3996527-3996576)
chr3 (379-431)||(3461757-3461809)
chr3 (376-416)||(4010066-4010106)
chr3 (363-415)||(24130553-24130605)
chr3 (360-431)||(52030111-52030183)
[»] scaffold0036 (1 HSPs)
scaffold0036 (362-431)||(25018-25088)
[»] chr8 (24 HSPs)
chr8 (363-429)||(39432363-39432429)
chr8 (363-431)||(2800012-2800081)
chr8 (361-430)||(6372637-6372706)
chr8 (363-432)||(18577107-18577176)
chr8 (363-408)||(32940370-32940415)
chr8 (376-432)||(26657863-26657919)
chr8 (363-429)||(14011073-14011139)
chr8 (363-424)||(14012605-14012667)
chr8 (363-429)||(29937204-29937270)
chr8 (370-416)||(39208909-39208955)
chr8 (363-431)||(2696526-2696595)
chr8 (363-432)||(24572883-24572952)
chr8 (363-432)||(41793005-41793073)
chr8 (366-410)||(216201-216245)
chr8 (366-410)||(220416-220460)
chr8 (366-410)||(689571-689615)
chr8 (366-410)||(692761-692805)
chr8 (366-410)||(696970-697014)
chr8 (366-410)||(729824-729868)
chr8 (366-410)||(734039-734083)
chr8 (366-410)||(853719-853763)
chr8 (366-410)||(857935-857979)
chr8 (363-418)||(10292345-10292401)
chr8 (395-431)||(10970292-10970328)
[»] chr5 (12 HSPs)
chr5 (363-424)||(9963409-9963471)
chr5 (367-432)||(11246526-11246591)
chr5 (363-432)||(25660906-25660975)
chr5 (363-430)||(17557024-17557091)
chr5 (364-430)||(35813276-35813342)
chr5 (362-415)||(38040259-38040312)
chr5 (363-431)||(3535969-3536037)
chr5 (388-428)||(31292548-31292588)
chr5 (376-431)||(42781627-42781682)
chr5 (363-431)||(1463864-1463933)
chr5 (369-406)||(25824079-25824116)
chr5 (363-424)||(27006334-27006395)
[»] chr7 (20 HSPs)
chr7 (363-431)||(21285386-21285455)
chr7 (363-431)||(35195837-35195905)
chr7 (376-431)||(10020502-10020557)
chr7 (363-432)||(14818397-14818467)
chr7 (363-432)||(15265395-15265465)
chr7 (366-431)||(31475873-31475939)
chr7 (363-431)||(20527462-20527531)
chr7 (376-432)||(37995578-37995633)
chr7 (379-431)||(38032888-38032940)
chr7 (363-431)||(48174961-48175029)
chr7 (367-410)||(17305444-17305487)
chr7 (363-430)||(37917386-37917453)
chr7 (366-431)||(11808035-11808100)
chr7 (363-431)||(29658305-29658374)
chr7 (363-423)||(7392347-7392407)
chr7 (366-430)||(14772369-14772433)
chr7 (366-430)||(15222821-15222885)
chr7 (363-430)||(15912768-15912836)
chr7 (361-424)||(41139078-41139142)
chr7 (388-432)||(47355828-47355872)
[»] scaffold0126 (1 HSPs)
scaffold0126 (363-430)||(24995-25062)
[»] scaffold0112 (1 HSPs)
scaffold0112 (363-432)||(17963-18033)
[»] chr2 (12 HSPs)
chr2 (376-430)||(35352444-35352498)
chr2 (380-431)||(26975331-26975382)
chr2 (363-409)||(36277757-36277803)
chr2 (366-424)||(39334921-39334979)
chr2 (363-431)||(11133069-11133138)
chr2 (363-431)||(29034969-29035038)
chr2 (363-427)||(29664596-29664661)
chr2 (376-432)||(32527109-32527166)
chr2 (362-431)||(44487800-44487869)
chr2 (363-415)||(5772854-5772906)
chr2 (376-428)||(17896832-17896884)
chr2 (363-415)||(22355077-22355129)
[»] scaffold0119 (1 HSPs)
scaffold0119 (363-432)||(1033-1102)
[»] scaffold0712 (1 HSPs)
scaffold0712 (367-415)||(4518-4566)
[»] scaffold0709 (1 HSPs)
scaffold0709 (367-415)||(4538-4586)
[»] scaffold0054 (1 HSPs)
scaffold0054 (376-430)||(67168-67222)
[»] scaffold1808 (1 HSPs)
scaffold1808 (363-432)||(865-934)


Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-143; HSPs: 24)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 1 - 361
Target Start/End: Complemental strand, 41480685 - 41480313
Alignment:
1 aggagaggtctatgattggaagattcactgttgccgttcctgccatct-cctaatttgataccactcactt-----------------gataacaatttc 82  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||                 ||||||||||||    
41480685 aggagaggtttatgattggaagattcactgttgccgttcctgccatcttcctagtttgataccactcacttccaatttagcttcacttgataacaatttc 41480586  T
83 taactatggacctttgatatcaaaatggcttatatagtgtaccagtacttcttccgcttcacagctagatttgttttcgattttctgatatcatcattct 182  Q
    ||||||||||||||||||||||||||||||||||||||  || |||||||||   |||||||||||||||||||||||||||||||||||||||||||||    
41480585 taactatggacctttgatatcaaaatggcttatatagt--actagtacttct---gcttcacagctagatttgttttcgattttctgatatcatcattct 41480491  T
183 atcatggagaactaaaataatagggtgatggaacacgaggggtaatattaaacatgtacgatacaccttttctaaagcatttagttgaatactcttaact 282  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41480490 atcatggagaactaaaataatagggtgatggaacacgaggggtaatattaaacatgtacgatacaccttttctaaagcatttagttgaatactcttaact 41480391  T
283 tttgtacatttatcccacatttcattttcggcctatcacatagntaacctacataagcgaataagttagtatgaccgtt 361  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||  | |||||||||||||||||||    
41480390 tttgtacatttatcccacatttcattttcggcctatcacatag-taacctacataaatgcataagttagtatgaccgtt 41480313  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 149 - 226
Target Start/End: Complemental strand, 41489049 - 41488972
Alignment:
149 agatttgttttcgattttctgatatcatcattctatcatggagaactaaaataatagggtgatggaacacgaggggta 226  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
41489049 agatttgttttcgattttctgatatcatcattctatcatggaggactaaaataatagggtgatggaacacgaggggta 41488972  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 360 - 432
Target Start/End: Original strand, 20166307 - 20166379
Alignment:
360 ttggtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    ||||||||||||||  |||||||| |||||||||||||||||||||||||| ||||| | ||||| |||||||    
20166307 ttggtccccgtgagcgtagctcagttggcagggacatgcattgttatatgcaggggccgaggttcgaacccca 20166379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 363 - 431
Target Start/End: Complemental strand, 49039546 - 49039478
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| |||||||||||||||||||||||||| ||| ||||||||| ||||||    
49039546 gtccccgtgagcatagctcagttggcagggacatgcattgttatatgcagggactggggttcgaacccc 49039478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 363 - 431
Target Start/End: Complemental strand, 54854280 - 54854212
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| ||||||||||||||||  |||||||| ||||||||||||| ||||||    
54854280 gtccccgtgagcatagctcagttggcagggacatgcataattatatgcaggggctggggttcgaacccc 54854212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 41489787 - 41489728
Alignment:
1 aggagaggtctatgattggaagattcactgttgccgttcctgccatctcctaatttgata 60  Q
    |||||||||||||||| |||||| ||| |||||| ||||||||||||||||| |||||||    
41489787 aggagaggtctatgataggaagactcaatgttgctgttcctgccatctcctagtttgata 41489728  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 363 - 429
Target Start/End: Complemental strand, 41492599 - 41492533
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacc 429  Q
    |||||||||||  |||||||| ||||||||||||||||| |||||||| ||||| ||||||| ||||    
41492599 gtccccgtgagcatagctcagttggcagggacatgcattattatatgcaggggccggggttcgaacc 41492533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 36008268 - 36008337
Alignment:
363 gtccccgtgagtctagctcagctggcagggaca-tgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| ||||||||||| ||||||||||||||| ||||| ||||||| ||||||    
36008268 gtccccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaacccc 36008337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 53815689 - 53815758
Alignment:
363 gtccccgtgagtctagctcagctggcagggaca-tgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| ||||||||||| |||||| |||||||| ||||||||||||| ||||||    
53815689 gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaacccc 53815758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 376 - 424
Target Start/End: Original strand, 20610746 - 20610794
Alignment:
376 tagctcagctggcagggacatgcattgttatatgccggggctggggttc 424  Q
    |||||||| |||||||||||||||||||||||||| ||||| |||||||    
20610746 tagctcagttggcagggacatgcattgttatatgcaggggccggggttc 20610794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 366 - 432
Target Start/End: Original strand, 27921893 - 27921959
Alignment:
366 cccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    ||||||||  |||||||| ||| ||||||||||||| |||||||| ||||| ||||||| |||||||    
27921893 cccgtgagcatagctcagttggtagggacatgcattattatatgcaggggccggggttcgaacccca 27921959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 363 - 424
Target Start/End: Original strand, 48512192 - 48512254
Alignment:
363 gtccccgtgagtctagctcagctggcagggaca-tgcattgttatatgccggggctggggttc 424  Q
    |||||||||||  |||||||| ||||||||||| ||||||||||||||| |||||| ||||||    
48512192 gtccccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggctagggttc 48512254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 363 - 431
Target Start/End: Complemental strand, 28520833 - 28520764
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| |||||||||| ||||||| |||||||| ||||| ||||||| ||||||    
28520833 gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaacccc 28520764  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 379 - 432
Target Start/End: Complemental strand, 37997931 - 37997878
Alignment:
379 ctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    ||||| |||||||||||| ||||||||||||| ||| ||||||||| |||||||    
37997931 ctcagttggcagggacattcattgttatatgcagggtctggggttcgaacccca 37997878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 29785144 - 29785212
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| |||||||||||| || ||| |||||  ||||||||||||| ||||||    
29785144 gtccccgtgagcatagctcagttggcagggacatacactgtaatatgtaggggctggggttcgaacccc 29785212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 379 - 430
Target Start/End: Complemental strand, 4419771 - 4419720
Alignment:
379 ctcagctggcagggacatgcattgttatatgccggggctggggttcaaaccc 430  Q
    ||||| || ||| ||||||||||||||||||| ||||| |||||||||||||    
4419771 ctcagttgtcagagacatgcattgttatatgcaggggccggggttcaaaccc 4419720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 360 - 431
Target Start/End: Original strand, 36257685 - 36257756
Alignment:
360 ttggtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    ||||||||||||||  |||||||| ||||||||||| ||| | || ||||| ||||| ||||||| ||||||    
36257685 ttggtccccgtgagcatagctcagttggcagggacaagcagtattgtatgcaggggccggggttcgaacccc 36257756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 363 - 410
Target Start/End: Original strand, 38657534 - 38657581
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgc 410  Q
    |||||||||||  | |||||| ||||||||||||||||||||||||||    
38657534 gtccccgtgagcatggctcagttggcagggacatgcattgttatatgc 38657581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 380 - 430
Target Start/End: Original strand, 15853833 - 15853883
Alignment:
380 tcagctggcagggacatgcattgttatatgccggggctggggttcaaaccc 430  Q
    |||| ||||||| |||||||||||||||| | ||||||||||||| |||||    
15853833 tcagttggcaggaacatgcattgttatatacaggggctggggttcgaaccc 15853883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 361 - 431
Target Start/End: Original strand, 49319385 - 49319455
Alignment:
361 tggtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||| ||||||  |||||||| ||||| ||||||||||| |||||||| ||||  ||||||| ||||||    
49319385 tggtcctcgtgagcatagctcagttggcatggacatgcattattatatgcaggggtcggggttccaacccc 49319455  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 9692955 - 9693024
Alignment:
363 gtccccgtgagtctagctcagctggcaggga-catgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| |||||||||  ||||||| |||||||| ||||| ||||||| ||||||    
9692955 gtccccgtgagcatagctcagttggcagggataatgcattattatatgcaggggccggggttcgaacccc 9693024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 14149786 - 14149855
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccc 431  Q
    ||||||||||   |||||||| |||||||||| ||||||| |||||||| ||||| ||||||| ||||||    
14149786 gtccccgtgaccatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaacccc 14149855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 379 - 424
Target Start/End: Original strand, 42432018 - 42432063
Alignment:
379 ctcagctggcagggacatgcattgttatatgccggggctggggttc 424  Q
    ||||| |||||||||||||||||||||||||| |||  ||||||||    
42432018 ctcagttggcagggacatgcattgttatatgcagggattggggttc 42432063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 431
Target Start/End: Complemental strand, 48968312 - 48968243
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  ||| |||| |||||||||| ||||||| |||||||| ||||| ||||||| ||||||    
48968312 gtccccgtgagcatagttcagttggcagggacaatgcattattatatgcaggggccggggttcgaacccc 48968243  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0168 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0168
Description:

Target: scaffold0168; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 363 - 424
Target Start/End: Complemental strand, 34134 - 34073
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttc 424  Q
    |||||||||||  |||||||| |||||||||||||||||||||||||| ||||| |||||||    
34134 gtccccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccggggttc 34073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 16)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 363 - 424
Target Start/End: Original strand, 34524869 - 34524930
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttc 424  Q
    |||||||||||  |||||||| |||||||||||||||||||||||||| ||||| |||||||    
34524869 gtccccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccggggttc 34524930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 378 - 430
Target Start/End: Complemental strand, 8253676 - 8253624
Alignment:
378 gctcagctggcagggacatgcattgttatatgccggggctggggttcaaaccc 430  Q
    |||||| ||||| |||||||||||||||||||| ||||||||||||| |||||    
8253676 gctcagttggcatggacatgcattgttatatgcaggggctggggttcgaaccc 8253624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 10455736 - 10455804
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  ||| |||| ||||||| |||||||||||||||||| ||||| ||||||| ||||||    
10455736 gtccccgtgagcatagttcagttggcaggaacatgcattgttatatgcaggggccggggttcgaacccc 10455804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 363 - 429
Target Start/End: Original strand, 2945589 - 2945656
Alignment:
363 gtccccgtgagtctagctcagctggcagggaca-tgcattgttatatgccggggctggggttcaaacc 429  Q
    |||||||||||  |||||||| ||||||||||| ||||||||||||||| ||||  ||||||||||||    
2945589 gtccccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcggggttcaaacc 2945656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 363 - 429
Target Start/End: Original strand, 4844137 - 4844203
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacc 429  Q
    |||||| ||||| || ||||| |||||||||||||||||||||||||| ||||  |||||| |||||    
4844137 gtccccatgagtataactcagttggcagggacatgcattgttatatgcaggggtcggggtttaaacc 4844203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 363 - 432
Target Start/End: Original strand, 9064859 - 9064929
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||||||||  |||||||| |||||||||| ||||||| |||||||| ||||| ||||||| |||||||    
9064859 gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaacccca 9064929  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 379 - 424
Target Start/End: Complemental strand, 20858468 - 20858423
Alignment:
379 ctcagctggcagggacatgcattgttatatgccggggctggggttc 424  Q
    ||||| |||||||||||||||||||||||||| |||| ||||||||    
20858468 ctcagttggcagggacatgcattgttatatgcaggggttggggttc 20858423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 363 - 432
Target Start/End: Complemental strand, 26669760 - 26669691
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||||||||  |||||||| ||| ||||||||||||  |||||||  ||||||||||||| |||||||    
26669760 gtccccgtgagcatagctcagttggtagggacatgcataattatatgtaggggctggggttcgaacccca 26669691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 363 - 430
Target Start/End: Complemental strand, 14981804 - 14981736
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaaccc 430  Q
    |||||||||||  |||||||| |||||||||| ||||||| |||||||| ||||| ||||||| |||||    
14981804 gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccc 14981736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 30833011 - 30833079
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||| ||||  ||| |||| |||||||||||||||||||||||||| ||||  ||||||| ||||||    
30833011 gtccccatgagcatagttcagttggcagggacatgcattgttatatgcaggggtcggggttcgaacccc 30833079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 363 - 410
Target Start/End: Original strand, 9031760 - 9031807
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgc 410  Q
    ||||||||||   |||||||| ||||||||||||||||||||||||||    
9031760 gtccccgtgaacatagctcagttggcagggacatgcattgttatatgc 9031807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 376 - 410
Target Start/End: Original strand, 8309171 - 8309205
Alignment:
376 tagctcagctggcagggacatgcattgttatatgc 410  Q
    |||||||| ||||||||||||||||||||||||||    
8309171 tagctcagttggcagggacatgcattgttatatgc 8309205  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 362 - 432
Target Start/End: Complemental strand, 25064771 - 25064701
Alignment:
362 ggtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    ||||||||||||  ||| |||| ||| | ||||||||||| |||||||| |||| |||||||| |||||||    
25064771 ggtccccgtgagcatagttcagttggtatggacatgcattattatatgcaggggttggggttcgaacccca 25064701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 3448345 - 3448414
Alignment:
363 gtccccgtgagtctagctcagctggcagggaca-tgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||  ||||||||||| |||||||||||| || ||||| ||||||| ||||||    
3448345 gtccccgtgagcatagctcaattggcagggacaatgcattgttatacgcaggggccggggttcgaacccc 3448414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 424
Target Start/End: Original strand, 8175990 - 8176051
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttc 424  Q
    |||||||||||  |||||||| || ||| ||||||||||||||||||| ||| |||| ||||    
8175990 gtccccgtgagcatagctcagttgacagagacatgcattgttatatgcagggactggtgttc 8176051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 363 - 423
Target Start/End: Complemental strand, 2955205 - 2955145
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggtt 423  Q
    |||||||||||  ||| |||| || |||||||||||||| |||||||| ||||| ||||||    
2955205 gtccccgtgagcatagttcagatgccagggacatgcattattatatgcaggggcaggggtt 2955145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 27)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 363 - 424
Target Start/End: Original strand, 18003810 - 18003871
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttc 424  Q
    |||||||||||  |||||||| |||||||||||||||||||||||||| ||||| |||||||    
18003810 gtccccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccggggttc 18003871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 363 - 431
Target Start/End: Complemental strand, 9768910 - 9768842
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| |||||||||||||||||||||||||| ||||  ||||||| ||||||    
9768910 gtccccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggtcggggttcgaacccc 9768842  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 363 - 431
Target Start/End: Complemental strand, 52961183 - 52961115
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| ||||| |||||||||||||||||||| ||||| ||||||| ||||||    
52961183 gtccccgtgagcatagctcagttggcaaggacatgcattgttatatgcaggggccggggttcgaacccc 52961115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 363 - 430
Target Start/End: Complemental strand, 7906427 - 7906360
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaaccc 430  Q
    |||||||||||  ||| |||| ||| |||||||||||||||||||||| ||||||||||||| |||||    
7906427 gtccccgtgagcatagttcagttggtagggacatgcattgttatatgcaggggctggggttcgaaccc 7906360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 17350054 - 17350123
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||| |||||||| |||||||||| ||||||| |||||||| ||||| ||||||| ||||||    
17350054 gtccccgtgagtatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaacccc 17350123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 363 - 424
Target Start/End: Original strand, 42908765 - 42908826
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttc 424  Q
    |||||||||||  |||||||| |||||||||||||||||||||||||| ||||  |||||||    
42908765 gtccccgtgagcttagctcagttggcagggacatgcattgttatatgcaggggtcggggttc 42908826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 376 - 431
Target Start/End: Original strand, 16182816 - 16182871
Alignment:
376 tagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||| |||||| |||||||||| |||||||  ||||||||||||||||||||    
16182816 tagctcagttggcagagacatgcattattatatgtaggggctggggttcaaacccc 16182871  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 363 - 432
Target Start/End: Original strand, 18179322 - 18179391
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||||||||  || ||||| |||||||||||||||||||||||||| ||| | || |||| |||||||    
18179322 gtccccgtgagcataactcagttggcagggacatgcattgttatatgcagggaccggagttcgaacccca 18179391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 363 - 432
Target Start/End: Complemental strand, 33176204 - 33176135
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||| ||||  |||||||| ||| ||||| |||||||||||||||| |||||||| ||||||| ||||    
33176204 gtccccttgagcatagctcagttggtagggatatgcattgttatatgcaggggctggagttcaaatccca 33176135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 376 - 429
Target Start/End: Original strand, 50575908 - 50575961
Alignment:
376 tagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacc 429  Q
    |||||||| ||| ||||||||||||||||||||||  |||||||||||| ||||    
50575908 tagctcagttggaagggacatgcattgttatatgcaagggctggggttcgaacc 50575961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 379 - 431
Target Start/End: Complemental strand, 50199561 - 50199509
Alignment:
379 ctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    ||||| ||| |||||||||||||||||||||| ||||| ||||||| ||||||    
50199561 ctcagttggtagggacatgcattgttatatgcaggggccggggttcgaacccc 50199509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 376 - 431
Target Start/End: Complemental strand, 3341824 - 3341769
Alignment:
376 tagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||| ||||||||||||||||| |||||||| ||||| |||| || ||||||    
3341824 tagctcagttggcagggacatgcattattatatgcaggggccggggatcgaacccc 3341769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 362 - 424
Target Start/End: Original strand, 195037 - 195099
Alignment:
362 ggtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttc 424  Q
    |||||| |||||  |||||||| ||||||||||||||||  |||||||| ||||||| |||||    
195037 ggtccctgtgagcgtagctcagttggcagggacatgcataattatatgcaggggctgaggttc 195099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 366 - 424
Target Start/End: Complemental strand, 7015785 - 7015727
Alignment:
366 cccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttc 424  Q
    ||||||||  |||||||| |||| ||||||||||||||||||||  ||||||| |||||    
7015785 cccgtgagcatagctcagttggctgggacatgcattgttatatgtaggggctgaggttc 7015727  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 376 - 430
Target Start/End: Original strand, 19536724 - 19536778
Alignment:
376 tagctcagctggcagggacatgcattgttatatgccggggctggggttcaaaccc 430  Q
    |||||||| ||| |||||||||||||| ||||||  ||||||||||||| |||||    
19536724 tagctcagttggtagggacatgcattgctatatgtaggggctggggttcgaaccc 19536778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 363 - 424
Target Start/End: Original strand, 40678816 - 40678878
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttc 424  Q
    |||||||||||  |||||||| |||||||||| ||||||| |||||||| ||||| |||||||    
40678816 gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttc 40678878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 366 - 431
Target Start/End: Complemental strand, 52833205 - 52833139
Alignment:
366 cccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||| ||| ||||| |||||||||| ||||||| |||||||| ||||| ||||||| ||||||    
52833205 cccgtgagcctaactcagttggcagggacaatgcattattatatgcaggggccggggttcgaacccc 52833139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 431
Target Start/End: Complemental strand, 2052784 - 2052715
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| |||||||||| ||||||| | |||||| ||||| ||||||| ||||||    
2052784 gtccccgtgagcatagctcagttggcagggacaatgcattatcatatgcaggggccggggttcgaacccc 2052715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 376 - 409
Target Start/End: Original strand, 5862135 - 5862168
Alignment:
376 tagctcagctggcagggacatgcattgttatatg 409  Q
    |||||||| |||||||||||||||||||||||||    
5862135 tagctcagttggcagggacatgcattgttatatg 5862168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 415
Target Start/End: Original strand, 9527419 - 9527472
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccgggg 415  Q
    |||||||||||  |||||||| |||||||||| |||||||||||||||| ||||    
9527419 gtccccgtgagcatagctcagttggcagggacaatgcattgttatatgcagggg 9527472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 431
Target Start/End: Complemental strand, 19976654 - 19976585
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| |||||||||| ||| || ||||||||| ||||| ||||||| ||||||    
19976654 gtccccgtgagcatagctcagttggcagggacaatgtatggttatatgcaggggccggggttcgaacccc 19976585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 29491463 - 29491532
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| |||||||||| ||||||| |||||||| ||||  ||||||| ||||||    
29491463 gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaacccc 29491532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 39238709 - 39238778
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| |||||||||| ||||||| |||||||| ||||| | ||||| ||||||    
39238709 gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccgaggttcgaacccc 39238778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 432
Target Start/End: Original strand, 42801873 - 42801942
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    ||||||||||   |||||||| || ||| ||||||||||||||||||| | || |||||||| |||||||    
42801873 gtccccgtgaacatagctcagttgacagagacatgcattgttatatgcagaggttggggttcgaacccca 42801942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 376 - 429
Target Start/End: Original strand, 43020618 - 43020671
Alignment:
376 tagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacc 429  Q
    |||||| | ||||||||||||||||| |||||||| |||| |||||||| ||||    
43020618 tagctcggttggcagggacatgcattattatatgcaggggttggggttcgaacc 43020671  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 1721134 - 1721202
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    ||||| |||||  |||||||| ||| ||| |||||||||||||||||| ||||| ||| ||| ||||||    
1721134 gtccctgtgagcatagctcagttggtaggaacatgcattgttatatgcaggggccgggtttcgaacccc 1721202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 360 - 432
Target Start/End: Original strand, 9931078 - 9931150
Alignment:
360 ttggtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    ||||||||||||||  || ||||| | ||||||||||||||| ||||||||  | ||||| |||| |||||||    
9931078 ttggtccccgtgagcataactcagttagcagggacatgcattattatatgcaagagctggagttcgaacccca 9931150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 21)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 363 - 423
Target Start/End: Original strand, 40160729 - 40160789
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggtt 423  Q
    |||| ||||||  |||||||  |||||||||||||||||||||||||||||||||||||||    
40160729 gtcctcgtgagcatagctcaattggcagggacatgcattgttatatgccggggctggggtt 40160789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 363 - 429
Target Start/End: Complemental strand, 16874291 - 16874225
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacc 429  Q
    |||||||||||  |||||||| |||||||||||||||||||||||||| ||||| | ||||| ||||    
16874291 gtccccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccgaggttcgaacc 16874225  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 363 - 432
Target Start/End: Original strand, 43774178 - 43774248
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||||||||| |||||||| |||||||||| |||||||||||||||| ||||  ||||||| |||||||    
43774178 gtccccgtgagtatagctcagttggcagggacaatgcattgttatatgcaggggtcggggttcgaacccca 43774248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 363 - 432
Target Start/End: Original strand, 19137613 - 19137682
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||||||||  |||||||| ||||||| |||||||||||||||||| ||||| | ||||| |||||||    
19137613 gtccccgtgagcatagctcagttggcaggaacatgcattgttatatgcaggggccgaggttcgaacccca 19137682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 376 - 431
Target Start/End: Original strand, 2903715 - 2903770
Alignment:
376 tagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    ||||| || ||||| |||||| ||||||||||||| ||||||||||||||||||||    
2903715 tagcttagttggcatggacatacattgttatatgcaggggctggggttcaaacccc 2903770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 9624976 - 9625045
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| |||||||||| ||||||| |||||||| ||||| ||||||| ||||||    
9624976 gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaacccc 9625045  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 14868678 - 14868747
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| |||||||||| ||||||| |||||||| ||||| ||||||| ||||||    
14868678 gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaacccc 14868747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 363 - 431
Target Start/End: Complemental strand, 27183783 - 27183714
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| |||||||||| ||||||| |||||||| ||||| ||||||| ||||||    
27183783 gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaacccc 27183714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 367 - 420
Target Start/End: Complemental strand, 30745828 - 30745775
Alignment:
367 ccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggg 420  Q
    |||||||  |||||||| |||||||||||||||||||||||||| | |||||||    
30745828 ccgtgagcatagctcagttggcagggacatgcattgttatatgcggaggctggg 30745775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 379 - 432
Target Start/End: Complemental strand, 34407175 - 34407122
Alignment:
379 ctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    ||||| ||||||||||||||||| |||||||| |||| |||||||| |||||||    
34407175 ctcagttggcagggacatgcattattatatgcaggggttggggttcgaacccca 34407122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 47191366 - 47191435
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| |||||||||| ||||||| |||||||| |||||||| |||| ||||||    
47191366 gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggagttcgaacccc 47191435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 363 - 415
Target Start/End: Original strand, 12236593 - 12236645
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccgggg 415  Q
    |||||||||||  |||||||| ||||||||||||||||| |||||||| ||||    
12236593 gtccccgtgagcgtagctcagttggcagggacatgcattattatatgcagggg 12236645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 370 - 410
Target Start/End: Original strand, 51017791 - 51017831
Alignment:
370 tgagtctagctcagctggcagggacatgcattgttatatgc 410  Q
    ||||| |||||||| ||||||||||||||||||||||||||    
51017791 tgagtatagctcagttggcagggacatgcattgttatatgc 51017831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 379 - 430
Target Start/End: Complemental strand, 31108845 - 31108794
Alignment:
379 ctcagctggcagggacatgcattgttatatgccggggctggggttcaaaccc 430  Q
    ||||| ||||||||||||||||  |||||||| ||||||||||||| |||||    
31108845 ctcagttggcagggacatgcataattatatgcaggggctggggttcgaaccc 31108794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 376 - 410
Target Start/End: Complemental strand, 12143495 - 12143461
Alignment:
376 tagctcagctggcagggacatgcattgttatatgc 410  Q
    |||||||| ||||||||||||||||||||||||||    
12143495 tagctcagttggcagggacatgcattgttatatgc 12143461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 367 - 416
Target Start/End: Original strand, 3973300 - 3973349
Alignment:
367 ccgtgagtctagctcagctggcagggacatgcattgttatatgccggggc 416  Q
    |||||||  |||||||| ||| |||||||||||||||||||||| |||||    
3973300 ccgtgagcatagctcagttggtagggacatgcattgttatatgcaggggc 3973349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 367 - 416
Target Start/End: Complemental strand, 3996576 - 3996527
Alignment:
367 ccgtgagtctagctcagctggcagggacatgcattgttatatgccggggc 416  Q
    |||||||  |||||||| ||| |||||||||||||||||||||| |||||    
3996576 ccgtgagcatagctcagttggtagggacatgcattgttatatgcaggggc 3996527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 379 - 431
Target Start/End: Complemental strand, 3461809 - 3461757
Alignment:
379 ctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    ||||| || ||||||||||||||||||||||  |||| |||||||| ||||||    
3461809 ctcagttgacagggacatgcattgttatatgtaggggttggggttcgaacccc 3461757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 376 - 416
Target Start/End: Complemental strand, 4010106 - 4010066
Alignment:
376 tagctcagctggcagggacatgcattgttatatgccggggc 416  Q
    |||||||| ||| |||||||||||||||||||||| |||||    
4010106 tagctcagttggtagggacatgcattgttatatgcaggggc 4010066  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 363 - 415
Target Start/End: Original strand, 24130553 - 24130605
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccgggg 415  Q
    |||||||||||  || ||||| |||||||||||| ||||||||||||| ||||    
24130553 gtccccgtgagcataactcagttggcagggacatacattgttatatgcagggg 24130605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 360 - 431
Target Start/End: Original strand, 52030111 - 52030183
Alignment:
360 ttggtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccc 431  Q
    ||||||||||||||  || ||||| |||||||||| ||| ||| |||||||| ||||| ||||||| ||||||    
52030111 ttggtccccgtgagcataactcagttggcagggacaatgtattattatatgcaggggccggggttcgaacccc 52030183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0036 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0036
Description:

Target: scaffold0036; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 362 - 431
Target Start/End: Original strand, 25018 - 25088
Alignment:
362 ggtccccgtgagtctagctcagctggcagggaca-tgcattgttatatgccggggctggggttcaaacccc 431  Q
    ||||||||||||  |||||||| ||||||||||| |||||| |||||||| ||||||||||||| ||||||    
25018 ggtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaacccc 25088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 24)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 363 - 429
Target Start/End: Complemental strand, 39432429 - 39432363
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacc 429  Q
    |||||||||||  |||||||| ||||||||||||||| |||||||||| |||| |||||||| ||||    
39432429 gtccccgtgagcatagctcagttggcagggacatgcaatgttatatgcaggggttggggttcgaacc 39432363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 2800012 - 2800081
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| |||||||||| ||||||| |||||||| ||||| ||||||| ||||||    
2800012 gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaacccc 2800081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 361 - 430
Target Start/End: Complemental strand, 6372706 - 6372637
Alignment:
361 tggtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaaccc 430  Q
    ||||| |||||||  |||||||| ||||||||||||||||  |||||||| |||| |||||||| |||||    
6372706 tggtctccgtgaggatagctcagttggcagggacatgcataattatatgcagggggtggggttcgaaccc 6372637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 363 - 432
Target Start/End: Original strand, 18577107 - 18577176
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||||||||  || ||||| || |||||||||| |||||||||||| ||||  |||||||||||||||    
18577107 gtccccgtgagcataactcagttgacagggacatgtattgttatatgcaggggtcggggttcaaacccca 18577176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 363 - 408
Target Start/End: Complemental strand, 32940415 - 32940370
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatat 408  Q
    |||||||||||| |||||||| || |||||||||||||||||||||    
32940415 gtccccgtgagtatagctcagttgacagggacatgcattgttatat 32940370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 376 - 432
Target Start/End: Original strand, 26657863 - 26657919
Alignment:
376 tagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||||| ||| |||||||||||||||||||||| ||| | ||||||| |||||||    
26657863 tagctcagttggtagggacatgcattgttatatgcagggaccggggttcgaacccca 26657919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 363 - 429
Target Start/End: Complemental strand, 14011139 - 14011073
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacc 429  Q
    ||||| |||||  ||| |||| |||||||||||||||||||||||||| ||||| || |||| ||||    
14011139 gtccctgtgagcatagttcagttggcagggacatgcattgttatatgcaggggccggagttcgaacc 14011073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 363 - 424
Target Start/End: Original strand, 14012605 - 14012667
Alignment:
363 gtccccgtgagtctagctcagctggcagggaca-tgcattgttatatgccggggctggggttc 424  Q
    |||||||||||  ||| |||| ||||||||||| ||||||||||||||| ||||| |||||||    
14012605 gtccccgtgagcatagttcagttggcagggacaatgcattgttatatgcaggggccggggttc 14012667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 363 - 429
Target Start/End: Original strand, 29937204 - 29937270
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacc 429  Q
    |||||||||||  |||||||| ||| ||||||||| |||||||||||| ||||| || |||| ||||    
29937204 gtccccgtgagcatagctcagttggtagggacatgtattgttatatgcaggggccggagttcgaacc 29937270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 370 - 416
Target Start/End: Complemental strand, 39208955 - 39208909
Alignment:
370 tgagtctagctcagctggcagggacatgcattgttatatgccggggc 416  Q
    |||||||||||||| | ||||||||||||||| |||||||| |||||    
39208955 tgagtctagctcagtttgcagggacatgcattattatatgcaggggc 39208909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 2696526 - 2696595
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  || ||||| |||||||||| ||||||| |||||||| ||||| ||||||| ||||||    
2696526 gtccccgtgagcataactcagttggcagggacaatgcattattatatgcaggggccggggttcgaacccc 2696595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 432
Target Start/End: Complemental strand, 24572952 - 24572883
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||||||||  |||||||| |||||| |||||| || ||||||||  | ||| |||||||||||||||    
24572952 gtccccgtgagcatagctcagttggcagagacatgtatcgttatatgtagaggccggggttcaaacccca 24572883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 432
Target Start/End: Complemental strand, 41793073 - 41793005
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||||||||  |||||||  ||||||| |||||||||||||||||| || || ||||||| |||||||    
41793073 gtccccgtgagcatagctcaattggcagg-acatgcattgttatatgcaggagccggggttcgaacccca 41793005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 366 - 410
Target Start/End: Complemental strand, 216245 - 216201
Alignment:
366 cccgtgagtctagctcagctggcagggacatgcattgttatatgc 410  Q
    ||||||||  |||||||| |||||||||||| |||||||||||||    
216245 cccgtgagcatagctcagttggcagggacatacattgttatatgc 216201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 366 - 410
Target Start/End: Complemental strand, 220460 - 220416
Alignment:
366 cccgtgagtctagctcagctggcagggacatgcattgttatatgc 410  Q
    ||||||||  |||||||| ||||||||||||||| ||||||||||    
220460 cccgtgagcatagctcagttggcagggacatgcaatgttatatgc 220416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 366 - 410
Target Start/End: Complemental strand, 689615 - 689571
Alignment:
366 cccgtgagtctagctcagctggcagggacatgcattgttatatgc 410  Q
    ||||||||  |||||||| ||||||||||||||| ||||||||||    
689615 cccgtgagcatagctcagttggcagggacatgcaatgttatatgc 689571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 366 - 410
Target Start/End: Complemental strand, 692805 - 692761
Alignment:
366 cccgtgagtctagctcagctggcagggacatgcattgttatatgc 410  Q
    ||||||||  |||||||| |||||||||||| |||||||||||||    
692805 cccgtgagcatagctcagttggcagggacatacattgttatatgc 692761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 366 - 410
Target Start/End: Complemental strand, 697014 - 696970
Alignment:
366 cccgtgagtctagctcagctggcagggacatgcattgttatatgc 410  Q
    ||||||||  |||||||| |||||||||||| |||||||||||||    
697014 cccgtgagcatagctcagttggcagggacatacattgttatatgc 696970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 366 - 410
Target Start/End: Complemental strand, 729868 - 729824
Alignment:
366 cccgtgagtctagctcagctggcagggacatgcattgttatatgc 410  Q
    ||||||||  |||||||| |||||||||||| |||||||||||||    
729868 cccgtgagcatagctcagttggcagggacatacattgttatatgc 729824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 366 - 410
Target Start/End: Complemental strand, 734083 - 734039
Alignment:
366 cccgtgagtctagctcagctggcagggacatgcattgttatatgc 410  Q
    ||||||||  |||||||| ||||||||||||||| ||||||||||    
734083 cccgtgagcatagctcagttggcagggacatgcaatgttatatgc 734039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 366 - 410
Target Start/End: Complemental strand, 853763 - 853719
Alignment:
366 cccgtgagtctagctcagctggcagggacatgcattgttatatgc 410  Q
    ||||||||  |||||||| |||||||||||| |||||||||||||    
853763 cccgtgagcatagctcagttggcagggacatacattgttatatgc 853719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 366 - 410
Target Start/End: Complemental strand, 857979 - 857935
Alignment:
366 cccgtgagtctagctcagctggcagggacatgcattgttatatgc 410  Q
    ||||||||  |||||||| ||||||||||||||| ||||||||||    
857979 cccgtgagcatagctcagttggcagggacatgcaatgttatatgc 857935  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 363 - 418
Target Start/End: Original strand, 10292345 - 10292401
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctg 418  Q
    |||||||||||  |||||||| |||||||||| ||||||| |||||||| |||||||    
10292345 gtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctg 10292401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 395 - 431
Target Start/End: Original strand, 10970292 - 10970328
Alignment:
395 atgcattgttatatgccggggctggggttcaaacccc 431  Q
    ||||||| |||||||| ||||||||||||||||||||    
10970292 atgcattattatatgcaggggctggggttcaaacccc 10970328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 12)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 363 - 424
Target Start/End: Original strand, 9963409 - 9963471
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttc 424  Q
    |||||||||||| |||||||| |||||||||| |||||||||||||||| |||| ||||||||    
9963409 gtccccgtgagtatagctcagttggcagggacaatgcattgttatatgcaggggttggggttc 9963471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 367 - 432
Target Start/End: Complemental strand, 11246591 - 11246526
Alignment:
367 ccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||||  |||||||| |||||||||||||||||||||||||| ||||  |||| ||||||||||    
11246591 ccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggtcggggctcaaacccca 11246526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 363 - 432
Target Start/End: Original strand, 25660906 - 25660975
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||||||||  |||||||| ||||||||| |||||||||||||||| ||||| ||| ||| |||||||    
25660906 gtccccgtgagcatagctcagttggcagggatatgcattgttatatgcaggggccgggattcgaacccca 25660975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 363 - 430
Target Start/End: Original strand, 17557024 - 17557091
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaaccc 430  Q
    ||||||||||| ||| ||||| |||||| ||||||||||||||||||  ||||  |||||||||||||    
17557024 gtccccgtgagcctaactcagttggcagagacatgcattgttatatgtaggggtcggggttcaaaccc 17557091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 364 - 430
Target Start/End: Complemental strand, 35813342 - 35813276
Alignment:
364 tccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaaccc 430  Q
    ||||||||||  |||||||| || ||||||||||||||||||||||| ||||||  ||||| |||||    
35813342 tccccgtgagcatagctcagttgacagggacatgcattgttatatgcaggggctcaggttcgaaccc 35813276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 362 - 415
Target Start/End: Original strand, 38040259 - 38040312
Alignment:
362 ggtccccgtgagtctagctcagctggcagggacatgcattgttatatgccgggg 415  Q
    ||||||| ||||  |||||||| |||||||||||||||||||||||||| ||||    
38040259 ggtccccatgagcatagctcagttggcagggacatgcattgttatatgcagggg 38040312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 363 - 431
Target Start/End: Complemental strand, 3536037 - 3535969
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  ||| |||| |||||||||||||||||||||||| | || || ||||||| ||||||    
3536037 gtccccgtgagcatagttcagttggcagggacatgcattgttatatacaggagccggggttcgaacccc 3535969  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 388 - 428
Target Start/End: Original strand, 31292548 - 31292588
Alignment:
388 cagggacatgcattgttatatgccggggctggggttcaaac 428  Q
    ||||||||||||||||||||||| || ||||||||||||||    
31292548 cagggacatgcattgttatatgcaggagctggggttcaaac 31292588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 376 - 431
Target Start/End: Complemental strand, 42781682 - 42781627
Alignment:
376 tagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||| |||||||||||||||||||||||||| |||   ||||||| ||||||    
42781682 tagctcagttggcagggacatgcattgttatatgcagggttcggggttcgaacccc 42781627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 1463864 - 1463933
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccc 431  Q
    ||||| |||||  |||||||| |||||||||| ||||||| |||||||| ||||| ||||||| ||||||    
1463864 gtccctgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaacccc 1463933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 369 - 406
Target Start/End: Complemental strand, 25824116 - 25824079
Alignment:
369 gtgagtctagctcagctggcagggacatgcattgttat 406  Q
    |||||| ||||||||||| |||||||||||||||||||    
25824116 gtgagtatagctcagctgtcagggacatgcattgttat 25824079  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 424
Target Start/End: Original strand, 27006334 - 27006395
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttc 424  Q
    |||||||||||  ||| |||| |||||||| ||||||||||||||||| ||||  |||||||    
27006334 gtccccgtgagcataggtcagatggcaggggcatgcattgttatatgctggggtcggggttc 27006395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 38; Significance: 0.000000000003; HSPs: 20)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 363 - 431
Target Start/End: Complemental strand, 21285455 - 21285386
Alignment:
363 gtccccgtgagtctagctcagctggcagggaca-tgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| ||||||||||| ||||||||||||||| ||||| ||||||| ||||||    
21285455 gtccccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaacccc 21285386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 35195837 - 35195905
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||| ||  |||||||| ||||||||||||||||| |||||||| ||||| ||||||| ||||||    
35195837 gtccccgtaagcatagctcagttggcagggacatgcattattatatgcaggggccggggttcgaacccc 35195905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 376 - 431
Target Start/End: Complemental strand, 10020557 - 10020502
Alignment:
376 tagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||| || ||||||||||||||||||||||| |||| |||||||| ||||||    
10020557 tagctcagttgacagggacatgcattgttatatgcaggggttggggttcgaacccc 10020502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 363 - 432
Target Start/End: Complemental strand, 14818467 - 14818397
Alignment:
363 gtccccgtgagtctagctcagctggcagggaca-tgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||||||||  |||||||| ||||||||||| |||||| |||||||| ||||  |||||||||||||||    
14818467 gtccccgtgagcatagctcagttggcagggacagtgcattattatatgcaggggtcggggttcaaacccca 14818397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 363 - 432
Target Start/End: Complemental strand, 15265465 - 15265395
Alignment:
363 gtccccgtgagtctagctcagctggcagggaca-tgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||||||||  |||||||| ||||||||||| |||||| |||||||| ||||  |||||||||||||||    
15265465 gtccccgtgagcatagctcagttggcagggacagtgcattattatatgcaggggtcggggttcaaacccca 15265395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 366 - 431
Target Start/End: Complemental strand, 31475939 - 31475873
Alignment:
366 cccgtgagtctagctcagctggcagggacat-gcattgttatatgccggggctggggttcaaacccc 431  Q
    ||||||||  |||||||| |||||||||||| ||||| |||||||| ||||||||||||| ||||||    
31475939 cccgtgagcatagctcagttggcagggacattgcattattatatgcaggggctggggttcgaacccc 31475873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 363 - 431
Target Start/End: Complemental strand, 20527531 - 20527462
Alignment:
363 gtccccgtgagtctagctcagctggcagggaca-tgcattgttatatgccggggctggggttcaaacccc 431  Q
    ||||| |||||| |||||||| ||||||||||| ||||||||||||||| ||||| || |||| ||||||    
20527531 gtccctgtgagtatagctcagttggcagggacaatgcattgttatatgcaggggccggagttcgaacccc 20527462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 376 - 432
Target Start/End: Complemental strand, 37995633 - 37995578
Alignment:
376 tagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||||| |||||| ||||||||| ||||||||| ||||| |||||||||||||||    
37995633 tagctcagttggcagagacatgcat-gttatatgcaggggccggggttcaaacccca 37995578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 379 - 431
Target Start/End: Complemental strand, 38032940 - 38032888
Alignment:
379 ctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    ||||| |||||||||||||||||||||||| | ||||| ||||||| ||||||    
38032940 ctcagttggcagggacatgcattgttatatacaggggccggggttcgaacccc 38032888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 48174961 - 48175029
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||| |||||||| ||||| ||||||||||| |||||| | ||||| || |||| ||||||    
48174961 gtccccgtgagtatagctcagttggcaaggacatgcattattatatacaggggccggtgttcgaacccc 48175029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 367 - 410
Target Start/End: Complemental strand, 17305487 - 17305444
Alignment:
367 ccgtgagtctagctcagctggcagggacatgcattgttatatgc 410  Q
    |||||||  |||||||| ||||||||||||||||||||||||||    
17305487 ccgtgagcatagctcagttggcagggacatgcattgttatatgc 17305444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 363 - 430
Target Start/End: Original strand, 37917386 - 37917453
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaaccc 430  Q
    |||||||||||  |||||||| ||| ||| ||||||||  |||||||| |||| ||||||||||||||    
37917386 gtccccgtgagcatagctcagttggtaggaacatgcataattatatgcaggggttggggttcaaaccc 37917453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 366 - 431
Target Start/End: Original strand, 11808035 - 11808100
Alignment:
366 cccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    ||||||||  |||||||  ||| |||||||||||||||||||||| ||||  ||||||| ||||||    
11808035 cccgtgagcttagctcaattggtagggacatgcattgttatatgcaggggtcggggttcgaacccc 11808100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 431
Target Start/End: Complemental strand, 29658374 - 29658305
Alignment:
363 gtccccgtgagtctagctcagctggcagggaca-tgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||  |||||| |||| ||||||||||||||| ||||| ||||||| ||||||    
29658374 gtccccgtgagcatagctcaattggcagcgacaatgcattgttatatgcaggggccggggttcgaacccc 29658305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 363 - 423
Target Start/End: Complemental strand, 7392407 - 7392347
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggtt 423  Q
    |||||||||||  |||||||  ||||||| |||||||||||||||||| | || |||||||    
7392407 gtccccgtgagcatagctcaattggcaggaacatgcattgttatatgcagaggttggggtt 7392347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 366 - 430
Target Start/End: Complemental strand, 14772433 - 14772369
Alignment:
366 cccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaaccc 430  Q
    ||||||||  || ||||| |||||| |||||||||||||| |||  ||||| |||||||||||||    
14772433 cccgtgagcataactcagttggcagagacatgcattgttacatgtaggggccggggttcaaaccc 14772369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 366 - 430
Target Start/End: Complemental strand, 15222885 - 15222821
Alignment:
366 cccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaaccc 430  Q
    ||||||||  || ||||| |||||| |||||||||||||| |||  ||||| |||||||||||||    
15222885 cccgtgagcataactcagttggcagagacatgcattgttacatgtaggggccggggttcaaaccc 15222821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 363 - 430
Target Start/End: Original strand, 15912768 - 15912836
Alignment:
363 gtccccgtgagtctagctcagctggcagggaca-tgcattgttatatgccggggctggggttcaaaccc 430  Q
    |||||||||||  |||||||  ||||||| ||| ||||||||||||||| |||| |||||||| |||||    
15912768 gtccccgtgagaatagctcaattggcaggaacaatgcattgttatatgcaggggttggggttcgaaccc 15912836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 361 - 424
Target Start/End: Original strand, 41139078 - 41139142
Alignment:
361 tggtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttc 424  Q
    |||||||||||||  |||||||| |||||||||| ||||||| |||||||| ||||  |||||||    
41139078 tggtccccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcggggttc 41139142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 388 - 432
Target Start/End: Original strand, 47355828 - 47355872
Alignment:
388 cagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||| |||||||||||||||| ||||| ||||||| |||||||    
47355828 cagggatatgcattgttatatgcaggggccggggttcgaacccca 47355872  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0126 (Bit Score: 36; Significance: 0.00000000004; HSPs: 1)
Name: scaffold0126
Description:

Target: scaffold0126; HSP #1
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 363 - 430
Target Start/End: Complemental strand, 25062 - 24995
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaaccc 430  Q
    |||||||||||  || ||||| |||||| |||||||| |||||||||| ||||| |||||||||||||    
25062 gtccccgtgagcatatctcagttggcagagacatgcaatgttatatgcaggggccggggttcaaaccc 24995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0112 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0112
Description:

Target: scaffold0112; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 363 - 432
Target Start/End: Complemental strand, 18033 - 17963
Alignment:
363 gtccccgtgagtctagctcagctggcagggaca-tgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||||||||  |||||||  ||| ||||||| ||||||||||||||| ||||||||||||| |||||||    
18033 gtccccgtgagcatagctcaattggtagggacaatgcattgttatatgcaggggctggggttcgaacccca 17963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 35; Significance: 0.0000000002; HSPs: 12)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 376 - 430
Target Start/End: Complemental strand, 35352498 - 35352444
Alignment:
376 tagctcagctggcagggacatgcattgttatatgccggggctggggttcaaaccc 430  Q
    |||||||| ||||||||||||||||  |||||||| ||||||||||||| |||||    
35352498 tagctcagttggcagggacatgcataattatatgcgggggctggggttcgaaccc 35352444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 380 - 431
Target Start/End: Complemental strand, 26975382 - 26975331
Alignment:
380 tcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||| |||||||||||||||||| ||||||| | ||||||||||| ||||||    
26975382 tcagttggcagggacatgcattgctatatgcagaggctggggttcgaacccc 26975331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 363 - 409
Target Start/End: Complemental strand, 36277803 - 36277757
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatg 409  Q
    |||||||||||  |||||||| |||||| ||||||||||||||||||    
36277803 gtccccgtgagcatagctcagttggcagtgacatgcattgttatatg 36277757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 366 - 424
Target Start/End: Complemental strand, 39334979 - 39334921
Alignment:
366 cccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttc 424  Q
    ||||||||  || ||||| ||||||||||||||||| |||||| | |||||||||||||    
39334979 cccgtgagcataactcagttggcagggacatgcattattatatacaggggctggggttc 39334921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 11133069 - 11133138
Alignment:
363 gtccccgtgagtctagctcagctggcagggaca-tgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||| ||| ||||||| ||||||||||||||| ||||  ||||||| ||||||    
11133069 gtccccgtgagcatagctcagttggtagggacaatgcattgttatatgcaggggtcggggttcgaacccc 11133138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 431
Target Start/End: Original strand, 29034969 - 29035038
Alignment:
363 gtccccgtgagtctagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccc 431  Q
    |||||||||||  |||||||  |||||||||| ||||||| |||||||| ||||| ||||||| ||||||    
29034969 gtccccgtgagcatagctcacttggcagggacaatgcattattatatgcaggggccggggttcgaacccc 29035038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 427
Target Start/End: Original strand, 29664596 - 29664661
Alignment:
363 gtccccgtgagtctagctcagctggcagggaca-tgcattgttatatgccggggctggggttcaaa 427  Q
    |||||||||||  |||||||  ||||||||||| ||||||||||||||| ||||  ||||||||||    
29664596 gtccccgtgagcatagctcaattggcagggacaatgcattgttatatgcaggggtcggggttcaaa 29664661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 376 - 432
Target Start/End: Complemental strand, 32527166 - 32527109
Alignment:
376 tagctcagctggcagggac-atgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||||| |||||||||| ||||||| |||||||| ||||| ||||||| |||||||    
32527166 tagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaacccca 32527109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 362 - 431
Target Start/End: Complemental strand, 44487869 - 44487800
Alignment:
362 ggtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccc 431  Q
    ||||||||||||| |||||||| ||  ||||||||||||| ||||||||  |||| || |||| ||||||    
44487869 ggtccccgtgagtatagctcagttgatagggacatgcattattatatgcaagggccggagttcgaacccc 44487800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 363 - 415
Target Start/End: Original strand, 5772854 - 5772906
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccgggg 415  Q
    |||||||||||  |||||||| ||||| ||||||| |||||||||||| ||||    
5772854 gtccccgtgagcatagctcagttggcaaggacatgtattgttatatgcagggg 5772906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 376 - 428
Target Start/End: Original strand, 17896832 - 17896884
Alignment:
376 tagctcagctggcagggacatgcattgttatatgccggggctggggttcaaac 428  Q
    |||||||| ||||||||||||||||  |||||| | |||| ||||||||||||    
17896832 tagctcagttggcagggacatgcataattatatacaggggttggggttcaaac 17896884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 363 - 415
Target Start/End: Original strand, 22355077 - 22355129
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccgggg 415  Q
    |||||||||||  |||||||| ||||| |||||||||||||||| ||| ||||    
22355077 gtccccgtgagcatagctcagttggcaaggacatgcattgttatgtgcagggg 22355129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0119
Description:

Target: scaffold0119; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 363 - 432
Target Start/End: Original strand, 1033 - 1102
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||||||||  |||||||| ||| ||||||||||||  |||||||  ||||||||||||| |||||||    
1033 gtccccgtgagcatagctcagttggtagggacatgcataattatatgtaggggctggggttcgaacccca 1102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0712 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0712
Description:

Target: scaffold0712; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 367 - 415
Target Start/End: Original strand, 4518 - 4566
Alignment:
367 ccgtgagtctagctcagctggcagggacatgcattgttatatgccgggg 415  Q
    |||||||  |||||||| |||||||||||||||||||||||||| ||||    
4518 ccgtgagcatagctcagttggcagggacatgcattgttatatgcagggg 4566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0709 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0709
Description:

Target: scaffold0709; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 367 - 415
Target Start/End: Original strand, 4538 - 4586
Alignment:
367 ccgtgagtctagctcagctggcagggacatgcattgttatatgccgggg 415  Q
    |||||||  |||||||| |||||||||||||||||||||||||| ||||    
4538 ccgtgagcatagctcagttggcagggacatgcattgttatatgcagggg 4586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0054 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: scaffold0054
Description:

Target: scaffold0054; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 376 - 430
Target Start/End: Original strand, 67168 - 67222
Alignment:
376 tagctcagctggcagggacatgcattgttatatgccggggctggggttcaaaccc 430  Q
    |||||||| ||| ||||| |||||||||||||||  ||||||||||||| |||||    
67168 tagctcagttgggagggatatgcattgttatatgtaggggctggggttcgaaccc 67222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold1808 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold1808
Description:

Target: scaffold1808; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 363 - 432
Target Start/End: Complemental strand, 934 - 865
Alignment:
363 gtccccgtgagtctagctcagctggcagggacatgcattgttatatgccggggctggggttcaaacccca 432  Q
    |||||||||||  || ||||| || ||||||||| ||||||||||||| | ||| || ||||||||||||    
934 gtccccgtgagcataactcagttgtcagggacatacattgttatatgcagaggccggagttcaaacccca 865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 176038 times since January 2019
Visitors: 1577