View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_6_89 (Length: 196)

Name: 108_6_89
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_6_89
108_6_89
[»] chr4 (4 HSPs)
chr4 (1-187)||(41480681-41480866)
chr4 (1-59)||(41494584-41494642)
chr4 (120-183)||(41489916-41489979)
chr4 (120-187)||(41494719-41494786)


Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 4)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 41480681 - 41480866
Alignment:
1 ctcctcacctgatcgtctttcctcagccaattccatccgtcaggtttttctatactaatnccccnttgaataaaatattagttcaacgcttgagaaatta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |  ||||||||||||||||||||||||||| |||||||    
41480681 ctcctcacctgatcgtctttcctcagccaattccatccgtcaggtttttctatactaattttc-tttgaataaaatattagttcaacgcttgcgaaatta 41480779  T
101 atgcaaatattgttaataatataggcatgtgttgagtatggtttcttttaccttgtgaaccacggngtgganaaagattttatgaag 187  Q
    ||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||    
41480780 atgcaaatatgtttaataatataggcatgtgttgagtatggtttcttttaccttgtgaaccacggtgtggacaaagattttatgaag 41480866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 1 - 59
Target Start/End: Original strand, 41494584 - 41494642
Alignment:
1 ctcctcacctgatcgtctttcctcagccaattccatccgtcaggtttttctatactaat 59  Q
    |||||||||||||||||| ||| |||||||||||||||||||||||||||| |||||||    
41494584 ctcctcacctgatcgtctatccacagccaattccatccgtcaggtttttctctactaat 41494642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 120 - 183
Target Start/End: Original strand, 41489916 - 41489979
Alignment:
120 tataggcatgtgttgagtatggtttcttttaccttgtgaaccacggngtgganaaagattttat 183  Q
    |||||||||| |||||||||||||| |||||||||||||||||||| |||||  | ||||||||    
41489916 tataggcatgcgttgagtatggttttttttaccttgtgaaccacggtgtggacgaggattttat 41489979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 120 - 187
Target Start/End: Original strand, 41494719 - 41494786
Alignment:
120 tataggcatgtgttgagtatggtttcttttaccttgtgaaccacggngtgganaaagattttatgaag 187  Q
    |||||||||| |||||||||||||||||||||||||||||||| || ||| |  | ||||||||||||    
41494719 tataggcatgcgttgagtatggtttcttttaccttgtgaaccatggtgtgaatgaggattttatgaag 41494786  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 105817 times since January 2019
Visitors: 1319