View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_6_90 (Length: 485)

Name: 108_6_90
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_6_90
108_6_90
[»] chr2 (1 HSPs)
chr2 (1-393)||(38747293-38747684)


Alignment Details
Target: chr2 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 1 - 393
Target Start/End: Complemental strand, 38747684 - 38747293
Alignment:
1 aaaacatgggttatcttgaatctcttgatgttccagaggaacagaatcagcaacagtttattgcntcaccttcttcttcttttgatcatcaacaacattt 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||| ||||||||||||||||||||    
38747684 aaaacatgggttatcttgaatctcttgatgttccagaggaacagaatcagcaacagtttattgtttcaccttcttcttcatttgatcatcaacaacattt 38747585  T
101 caatattctttcacaatcaattcatcagaatttgacaccaagtttcaatgatgttgacaataacatcattaacaacaatatgaacatgtttttgggaaat 200  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38747584 caatattctttcacaatccattcatcagaatttgacaccaagtttcaatgatgttgacaataacatcattaacaacaatatgaacatgtttttgggaaat 38747485  T
201 aacgacaaccttaataaggttgttggtggtggtgacgtcaatggtttgtcttgtcctgcgcctgatctcggatgggttaatgaactgcngatgtanaana 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||| || |    
38747484 aacgacaaccttaataaggttgttggtggtggtgacgtcaatggtttgtcttgtcctgcccctgatctcggatgggttaatgaactgctgatgtagaaga 38747385  T
301 gtgttgaattttgaagatggngcccaantggtgattatcagtggagtgaagtgtaaatattgnaggattaagcctatattacctatttatccc 393  Q
    |||||||||||||||||||| ||| || |||||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||||||||    
38747384 gtgttgaattttgaagatggtgccaaaatggtgattatcagtggagtgaagtgtaaatattgaaggattaag-ctatattacatatttatccc 38747293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 110699 times since January 2019
Visitors: 1335