View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_7_1 (Length: 457)

Name: 108_7_1
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_7_1
108_7_1
[»] chr2 (1 HSPs)
chr2 (5-433)||(7949792-7950235)
[»] chr8 (2 HSPs)
chr8 (64-110)||(26448793-26448839)
chr8 (85-158)||(24540739-24540812)
[»] chr1 (2 HSPs)
chr1 (81-138)||(34029487-34029544)
chr1 (68-156)||(49142029-49142117)


Alignment Details
Target: chr2 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 5 - 433
Target Start/End: Original strand, 7949792 - 7950235
Alignment:
5 caataccgatgtttgcagcaaaacatcctttggagtcaccctgattgtttctgaagat------------------gccagggttgccttgagaagcccc 86  Q
    |||||||||||||  |||||||||||||||||||||||||||||||||||||||||||                  ||||||||||||||||||||||||    
7949792 caataccgatgtt--cagcaaaacatcctttggagtcaccctgattgtttctgaagattccagcgcaagcaaataagccagggttgccttgagaagcccc 7949889  T
87 atcagtgttgcatttaatccaattatgaataggagggtgccagagaacctccacaatttttggagcattaggagtgtaaggttcaattctgaagagcttt 186  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| || |||||||||||| ||||||    
7949890 atcagtgttgcatttaatccaattatgaataggagggtgccagagatcctccacaatttttggagcattaggaatgtgagtttcaattctgaa-agcttt 7949988  T
187 caaaaccacaaagtctctgatggttgagctagttgctgcagatataaggttaccagataggttcacacttgcaatnatcanatttttagctgcaactaaa 286  Q
    ||||||||||||||||||||| | || ||||||| |||||||||||||||||||||||||||||||||||||||| ||||  ||||||||||||||||||    
7949989 caaaaccacaaagtctctgattgctgggctagttactgcagatataaggttaccagataggttcacacttgcaatgatcatgtttttagctgcaactaaa 7950088  T
287 tttggttngacattgttgaatttgaagttgtttctagagaaccatatgacatttatggtattgataaaagcagctgagatagtgagttagcttgagggct 386  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
7950089 tttggtttgacattgttgaatttgaagttgtttctagagaaccatatgacatttatggtattgataaaagcagttgagatagtgagttagcttgagggct 7950188  T
387 cgagcttctattacaagtatcaaatatattaaggatggaagacaaat 433  Q
    | |||||||||||||||||||||||||||||||||||||||||||||    
7950189 ccagcttctattacaagtatcaaatatattaaggatggaagacaaat 7950235  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.0000000002; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 64 - 110
Target Start/End: Original strand, 26448793 - 26448839
Alignment:
64 ccagggttgccttgagaagccccatcagtgttgcatttaatccaatt 110  Q
    |||||||||||||||||||| ||||| || |||||||||||||||||    
26448793 ccagggttgccttgagaagcaccatctgtattgcatttaatccaatt 26448839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 85 - 158
Target Start/End: Complemental strand, 24540812 - 24540739
Alignment:
85 ccatcagtgttgcatttaatccaattatgaataggagggtgccagagaacctccacaatttttggagcattagg 158  Q
    |||||||| || ||||| |||||||| | ||| ||||||||||||| ||| || | ||||||||||||||||||    
24540812 ccatcagtattacatttgatccaatttttaatgggagggtgccagataacttctataatttttggagcattagg 24540739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.0000002; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 81 - 138
Target Start/End: Original strand, 34029487 - 34029544
Alignment:
81 agccccatcagtgttgcatttaatccaattatgaataggagggtgccagagaacctcc 138  Q
    ||||||||||  |||||||||||||||  | | ||||||||||||||||| |||||||    
34029487 agccccatcacagttgcatttaatccatctctaaataggagggtgccagataacctcc 34029544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 68 - 156
Target Start/End: Original strand, 49142029 - 49142117
Alignment:
68 ggttgccttgagaagccccatcagtgttgcatttaatccaattatgaataggagggtgccagagaacctccacaatttttggagcatta 156  Q
    |||| ||||||||  | ||||||||||| ||||| | |||||| ||||| |||||||||  || ||||| ||  |||||||||||||||    
49142029 ggttaccttgagagactccatcagtgttacatttgacccaattgtgaatgggagggtgcgtgaaaaccttcatgatttttggagcatta 49142117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 361464 times since January 2019
Visitors: 488