View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_7_14 (Length: 123)

Name: 108_7_14
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_7_14
108_7_14
[»] chr8 (2 HSPs)
chr8 (1-62)||(38911862-38911923)
chr8 (56-123)||(38911800-38911866)


Alignment Details
Target: chr8 (Bit Score: 58; Significance: 8e-25; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 8e-25
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 38911862 - 38911923
Alignment:
1 gaaggcgcttggtttggcgaagtctttagaggatgaggatgctttggtcagacaaattaatc 62  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38911862 gaaggcacttggtttggcgaagtctttagaggatgaggatgctttggtcagacaaattaatc 38911923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 56 - 123
Target Start/End: Original strand, 38911800 - 38911866
Alignment:
56 attaatcttggtgaagtgcattaccggcantcanaagtatgaagaggngcggtcttgttatgagaagg 123  Q
    ||||||||||||||||||||||||||| | ||| ||||||||||||| ||||||||||||||||||||    
38911800 attaatcttggtgaagtgcattaccgg-actcagaagtatgaagaggcgcggtcttgttatgagaagg 38911866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 306787 times since January 2019
Visitors: 441