View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_7_27 (Length: 190)

Name: 108_7_27
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_7_27
108_7_27
[»] chr1 (1 HSPs)
chr1 (1-190)||(46695924-46696112)


Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 190
Target Start/End: Complemental strand, 46696112 - 46695924
Alignment:
1 tacacgaggtacttgtaaaatctttttcctagtttatgttgtttatgattttgaattacgataattgatcgatgtttctgataactctattattcantgn 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||     
46696112 tacacgaggtacttgtaaaatctttttcctagtttatgttgtttatgattttgaattacgataattgatcgatgtttctgataactctattattcattgc 46696013  T
101 taggaataaccttttggacaaatcaatgnatanagtttcntcngggnaatgtaaatnaaatatattcncatgaagaagctcttaagaatt 190  Q
    |||||||||||||||||||||||||||| ||| |||||| || ||| ||||||||| |||||||||| ||||||||||||||||||||||    
46696012 taggaataaccttttggacaaatcaatgcataaagtttcatctggg-aatgtaaataaaatatattcacatgaagaagctcttaagaatt 46695924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 106084 times since January 2019
Visitors: 1319