View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_7_46 (Length: 131)

Name: 108_7_46
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_7_46
108_7_46
[»] chr8 (2 HSPs)
chr8 (8-62)||(38911869-38911923)
chr8 (59-122)||(38911803-38911866)


Alignment Details
Target: chr8 (Bit Score: 52; Significance: 3e-21; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 3e-21
Query Start/End: Original strand, 8 - 62
Target Start/End: Original strand, 38911869 - 38911923
Alignment:
8 cttggtttggcgaagtctttagaggatgaggatgctttggtcagacaaatnaatc 62  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
38911869 cttggtttggcgaagtctttagaggatgaggatgctttggtcagacaaattaatc 38911923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000004
Query Start/End: Original strand, 59 - 122
Target Start/End: Original strand, 38911803 - 38911866
Alignment:
59 aatcntggtgaagtgnattancggaatnanatgtatgaagaggngcggtcttgttntgagaagg 122  Q
    |||| |||||||||| |||| |||| | | | ||||||||||| ||||||||||| ||||||||    
38911803 aatcttggtgaagtgcattaccggactcagaagtatgaagaggcgcggtcttgttatgagaagg 38911866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108135 times since January 2019
Visitors: 1329