View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_7_49 (Length: 458)

Name: 108_7_49
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_7_49
108_7_49
[»] chr8 (4 HSPs)
chr8 (139-458)||(18397702-18398018)
chr8 (139-458)||(11470774-11471090)
chr8 (1-145)||(11470496-11470640)
chr8 (5-145)||(18398156-18398296)
[»] chr4 (1 HSPs)
chr4 (140-261)||(31851136-31851256)


Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 139 - 458
Target Start/End: Original strand, 18397702 - 18398018
Alignment:
139 gaattctgatttatctcctcctcgtaaacacagagatcagagtgttacagctgtagctcgtgaaccaaggtcatctagatcaaagtttgaagatagtgat 238  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
18397702 gaattctgatttatctcctcctcgtaaacacagagatcagagtgttacagctgtagcttgtgaaccaaggtcatctagatcaaagtttgaagatagtgat 18397801  T
239 atgtcacctcctcgacggaaacatgttagtaactcgagtccagcatatttcccctcctcgccgtcgtagtcatcanacatctggatccaatgggagnnnn 338  Q
    |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||        
18397802 atgtcacctcctcgacggaaacatgttagtaattcgagtccag-atatttcccctcctcgccgtcgtagtcatcaaacatctggatccaatgggagaaaa 18397900  T
339 nnntatgaaactcctgatttggaagatctttctccncctagangtggncgtcatgattcccnctctcaagatactttacatggacaaggtgncatctgac 438  Q
       ||||||||| |||||||||||||||||||||| |||||| |||| ||||||||||||| ||||||||||||||||||||||||| ||| ||||||||    
18397901 aaatatgaaacttctgatttggaagatctttctccacctagacgtggtcgtcatgattccccctctcaagatactttacatggacaa-gtgtcatctgac 18397999  T
439 ctttccaccaccgangagac 458  Q
    |||| ||||||||| |||||    
18398000 cttt-caccaccgaggagac 18398018  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 139 - 458
Target Start/End: Complemental strand, 11471090 - 11470774
Alignment:
139 gaattctgatttatctcctcctcgtaaacacagagatcagagtgttacagctgtagctcgtgaaccaaggtcatctagatcaaagtttgaagatagtgat 238  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
11471090 gaattctgatttatctcctcctcgtaaacacagagatcagagtgttacagatgtagctcgtgaaccaaggtcatctagatcaaagtttgaagatagtgat 11470991  T
239 atgtcacctcctcgacggaaacatgttagtaactcgagtccagcatatttcccctcctcgccgtcgtagtcatcanacatctggatccaatgggagnnnn 338  Q
    |||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||        
11470990 atgtcacctcctcgacggaaacatgttagtaattcgagtccag-atatttcccctcctcgccgtcgtagtcatcaaacatctggatccaatgggagaaaa 11470892  T
339 nnntatgaaactcctgatttggaagatctttctccncctagangtggncgtcatgattcccnctctcaagatactttacatggacaaggtgncatctgac 438  Q
       ||||||||| |||||||||||||||||||||| |||||| |||| |||| |||||||| ||||||||||||||||||||||||| ||| ||||||||    
11470891 aaatatgaaacttctgatttggaagatctttctccacctagacgtggtcgtcttgattccccctctcaagatactttacatggacaa-gtgtcatctgac 11470793  T
439 ctttccaccaccgangagac 458  Q
    |||| ||||||||| |||||    
11470792 cttt-caccaccgaggagac 11470774  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 116; E-Value: 8e-59
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 11470640 - 11470496
Alignment:
1 tgttaatgaaagaaaaacaggtttaatttctggtaaggatatgagagaagagatcaacagaaaaaggaaggatgatttgttgaggtaattgttcaattat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
11470640 tgttaatgaaagaaaaacaggtttaatttctggtaaggatatgagagaagagatcgacagaaaaaggaaggatgatttgttgaggtaattgttcaattat 11470541  T
101 atgannnnnnnccaagcacatattcttatgtattagatgaattct 145  Q
    ||||       |||||||||||||||||||| |||||||||||||    
11470540 atgatttttttccaagcacatattcttatgttttagatgaattct 11470496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 5 - 145
Target Start/End: Original strand, 18398156 - 18398296
Alignment:
5 aatgaaagaaaaacaggtttaatttctggtaaggatatgagagaagagatcaacagaaaaaggaaggatgatttgttgaggtaattgttcaattatatga 104  Q
    |||||||| |||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
18398156 aatgaaaggaaaataggtttaatttctggtaaggatatgagagaagagatcgacagaaaaaggaaggatgatttgttgaggtaattgttcaattatatga 18398255  T
105 nnnnnnnccaagcacatattcttatgtattagatgaattct 145  Q
           |||||||||||||||||||| |||||||||||||    
18398256 tttttttccaagcacatattcttatgttttagatgaattct 18398296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 62; Significance: 1e-26; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 140 - 261
Target Start/End: Complemental strand, 31851256 - 31851136
Alignment:
140 aattctgatttatctcctcctcgtaaacacagagatcagagtgttacagctgtagctcgtgaaccaaggtcatctagatcaaagtttgaagatagtgata 239  Q
    ||||||||||||||||||||   |||| |||||||||||||| |||||  ||||||| ||||||||||||  |||| |||||| ||||||| ||||||||    
31851256 aattctgatttatctcctccatataaatacagagatcagagtattacaattgtagcttgtgaaccaaggttgtctaaatcaaaatttgaag-tagtgata 31851158  T
240 tgtcacctcctcgacggaaaca 261  Q
    |||||||||||||||| |||||    
31851157 tgtcacctcctcgacgaaaaca 31851136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 126574 times since January 2019
Visitors: 1391