View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_7_52 (Length: 143)

Name: 108_7_52
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_7_52
108_7_52
[»] chr2 (6 HSPs)
chr2 (1-143)||(41843387-41843529)
chr2 (32-101)||(20242729-20242798)
chr2 (24-108)||(34784976-34785060)
chr2 (25-97)||(36096370-36096442)
chr2 (32-71)||(5367210-5367249)
chr2 (27-68)||(28524447-28524488)
[»] chr1 (19 HSPs)
chr1 (4-68)||(1486683-1486747)
chr1 (27-101)||(10572586-10572660)
chr1 (32-77)||(30749852-30749897)
chr1 (32-77)||(30771303-30771348)
chr1 (24-68)||(44482251-44482295)
chr1 (24-98)||(25934607-25934681)
chr1 (34-100)||(34315701-34315767)
chr1 (30-68)||(1864880-1864918)
chr1 (35-108)||(10577740-10577813)
chr1 (30-68)||(13997904-13997942)
chr1 (4-68)||(20157323-20157388)
chr1 (27-68)||(34371734-34371775)
chr1 (32-68)||(2784577-2784613)
chr1 (32-68)||(9709841-9709877)
chr1 (24-68)||(25361907-25361951)
chr1 (24-68)||(31694704-31694748)
chr1 (32-106)||(1815240-1815314)
chr1 (25-68)||(5944304-5944347)
chr1 (32-71)||(13436476-13436515)
[»] chr5 (10 HSPs)
chr5 (26-108)||(6401479-6401561)
chr5 (29-82)||(39758279-39758332)
chr5 (5-68)||(23015964-23016027)
chr5 (24-97)||(21814253-21814326)
chr5 (32-97)||(30099040-30099105)
chr5 (4-64)||(14873542-14873602)
chr5 (4-68)||(31084344-31084408)
chr5 (4-68)||(39205901-39205965)
chr5 (32-82)||(32426871-32426921)
chr5 (24-68)||(22423806-22423850)
[»] chr7 (22 HSPs)
chr7 (4-68)||(9778521-9778585)
chr7 (4-68)||(1433475-1433539)
chr7 (4-68)||(5409810-5409874)
chr7 (4-68)||(32093994-32094058)
chr7 (32-108)||(18213035-18213112)
chr7 (32-82)||(39138451-39138501)
chr7 (24-68)||(15902843-15902887)
chr7 (1-48)||(20545220-20545267)
chr7 (25-68)||(22602705-22602748)
chr7 (32-75)||(24146830-24146873)
chr7 (4-50)||(21138970-21139016)
chr7 (22-75)||(7758336-7758389)
chr7 (32-68)||(640134-640170)
chr7 (32-68)||(3721114-3721150)
chr7 (4-68)||(13770712-13770776)
chr7 (31-75)||(17851445-17851489)
chr7 (32-68)||(19206071-19206107)
chr7 (32-64)||(23849460-23849492)
chr7 (24-127)||(32308082-32308185)
chr7 (4-68)||(43027443-43027507)
chr7 (32-75)||(22484039-22484082)
chr7 (31-62)||(29769480-29769511)
[»] chr6 (14 HSPs)
chr6 (4-126)||(28152062-28152178)
chr6 (4-94)||(17327629-17327719)
chr6 (32-101)||(5626698-5626767)
chr6 (24-97)||(16488584-16488657)
chr6 (24-97)||(18367828-18367901)
chr6 (26-68)||(9025490-9025532)
chr6 (24-96)||(8931596-8931668)
chr6 (26-67)||(9027200-9027241)
chr6 (4-108)||(12696305-12696409)
chr6 (32-68)||(7027263-7027299)
chr6 (32-68)||(7265595-7265631)
chr6 (24-68)||(9522912-9522956)
chr6 (24-68)||(11424705-11424749)
chr6 (24-68)||(26562710-26562754)
[»] chr4 (9 HSPs)
chr4 (27-77)||(44132641-44132691)
chr4 (19-68)||(15659749-15659798)
chr4 (4-68)||(3947740-3947804)
chr4 (26-108)||(5414168-5414250)
chr4 (32-77)||(19097896-19097941)
chr4 (32-68)||(9996861-9996897)
chr4 (32-68)||(18576039-18576075)
chr4 (24-68)||(22234884-22234928)
chr4 (4-68)||(23292965-23293024)
[»] chr3 (9 HSPs)
chr3 (32-97)||(35222930-35222995)
chr3 (4-68)||(27505267-27505331)
chr3 (32-81)||(13845527-13845576)
chr3 (4-68)||(29508465-29508530)
chr3 (32-68)||(7614417-7614453)
chr3 (32-68)||(7928471-7928507)
chr3 (32-68)||(8789552-8789588)
chr3 (32-68)||(18426970-18427006)
chr3 (32-68)||(40993337-40993373)
[»] scaffold0171 (1 HSPs)
scaffold0171 (15-68)||(23441-23494)
[»] scaffold0168 (1 HSPs)
scaffold0168 (24-68)||(21064-21108)
[»] chr8 (11 HSPs)
chr8 (32-127)||(14134661-14134756)
chr8 (32-84)||(18964182-18964234)
chr8 (25-68)||(21520763-21520806)
chr8 (27-68)||(11803280-11803321)
chr8 (27-68)||(11927083-11927124)
chr8 (79-127)||(36450803-36450851)
chr8 (32-68)||(4786340-4786376)
chr8 (32-68)||(8847277-8847313)
chr8 (32-68)||(26902177-26902213)
chr8 (25-108)||(34451032-34451115)
chr8 (89-128)||(31109577-31109616)
[»] scaffold0020 (1 HSPs)
scaffold0020 (26-68)||(135308-135350)
[»] scaffold0123 (1 HSPs)
scaffold0123 (24-68)||(44519-44563)


Alignment Details
Target: chr2 (Bit Score: 136; Significance: 3e-71; HSPs: 6)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 136; E-Value: 3e-71
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 41843529 - 41843387
Alignment:
1 cccgtgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtcagt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
41843529 cccgtgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgtcggcgtgtcagt 41843430  T
101 gcccgtgttcatatccgtgcttcatagaatgaaaagcaatata 143  Q
    | |||||||||||||||||||||||||||||||||||||||||    
41843429 gtccgtgttcatatccgtgcttcatagaatgaaaagcaatata 41843387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 32 - 101
Target Start/End: Original strand, 20242729 - 20242798
Alignment:
32 acaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtcagtg 101  Q
    ||||||||||||||||||| || |||||||||||||| |||||||| |||||| || |||||||||||||    
20242729 acaccgacacatataattacactgaattatgtgattttctaaaaaaattagttgtgtcggcgtgtcagtg 20242798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 46; E-Value: 1e-17
Query Start/End: Original strand, 24 - 108
Target Start/End: Original strand, 34784976 - 34785060
Alignment:
24 ccgacacaacaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtcagtgcccgtgt 108  Q
    ||||||| ||||||||||||||||||| ||  ||||||||||||| |||||||| |||||| || ||| ||||||||| ||||||    
34784976 ccgacacgacaccgacacatataattacactaaattatgtgattttctaaaaaaattagttgtgtcggtgtgtcagtgtccgtgt 34785060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 25 - 97
Target Start/End: Original strand, 36096370 - 36096442
Alignment:
25 cgacacaacaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtc 97  Q
    |||||| ||||||||| ||||||||| || | ||| |||||||| ||||||||||||| | || |||||||||    
36096370 cgacacgacaccgacaaatataattacactgcattttgtgattttctaaaaaatttagctgtgtcggcgtgtc 36096442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 32 - 71
Target Start/End: Complemental strand, 5367249 - 5367210
Alignment:
32 acaccgacacatataattataccgaattatgtgatttcct 71  Q
    ||||||||||||||||||| || |||||||||||||||||    
5367249 acaccgacacatataattacactgaattatgtgatttcct 5367210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 27 - 68
Target Start/End: Complemental strand, 28524488 - 28524447
Alignment:
27 acacaacaccgacacatataattataccgaattatgtgattt 68  Q
    |||||||| ||||||||||||||| || ||||||||||||||    
28524488 acacaacaacgacacatataattacactgaattatgtgattt 28524447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 45; Significance: 5e-17; HSPs: 19)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 1486683 - 1486747
Alignment:
4 gtgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||| ||||||||| |||||||||| |||||||| || ||||||||||||||    
1486683 gtgtcggacacgtgtcgtgtccgacacgacaccgacacttataattacactgaattatgtgattt 1486747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 27 - 101
Target Start/End: Original strand, 10572586 - 10572660
Alignment:
27 acacaacaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtcagtg 101  Q
    ||||||||||||||||| |||||| ||||||||||||||||| || |||   |||||  || |||||||||||||    
10572586 acacaacaccgacacatttaattacaccgaattatgtgattttctcaaattattagtggtgtcggcgtgtcagtg 10572660  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 32 - 77
Target Start/End: Complemental strand, 30749897 - 30749852
Alignment:
32 acaccgacacatataattataccgaattatgtgatttcctaaaaaa 77  Q
    ||||||||||||||||||| || |||||||||||||| ||||||||    
30749897 acaccgacacatataattacactgaattatgtgattttctaaaaaa 30749852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 32 - 77
Target Start/End: Complemental strand, 30771348 - 30771303
Alignment:
32 acaccgacacatataattataccgaattatgtgatttcctaaaaaa 77  Q
    ||||||||||||||||||| || |||||||||||||| ||||||||    
30771348 acaccgacacatataattacactgaattatgtgattttctaaaaaa 30771303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 24 - 68
Target Start/End: Complemental strand, 44482295 - 44482251
Alignment:
24 ccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||| ||||||||||||||||||| || ||||||||||||||    
44482295 ccgacacgacaccgacacatataattacactgaattatgtgattt 44482251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 24 - 98
Target Start/End: Complemental strand, 25934681 - 25934607
Alignment:
24 ccgacacaacaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtca 98  Q
    ||||||| | ||||||||||||||||| || | ||| |||||||| ||| ||||||||| | || ||||||||||    
25934681 ccgacacgataccgacacatataattacactgtattttgtgattttctagaaaatttagctgtgtcggcgtgtca 25934607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 34 - 100
Target Start/End: Complemental strand, 34315767 - 34315701
Alignment:
34 accgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtcagt 100  Q
    ||||||||||||||||| ||||||||||||  |||  |||||||||||| | || |||| |||||||    
34315767 accgacacatataattacaccgaattatgtagttttttaaaaaatttagctgtgtcggcatgtcagt 34315701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 30 - 68
Target Start/End: Original strand, 1864880 - 1864918
Alignment:
30 caacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||||||| || ||||||||||||||    
1864880 caacaccgacacatataattacactgaattatgtgattt 1864918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 35 - 108
Target Start/End: Original strand, 10577740 - 10577813
Alignment:
35 ccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtcagtgcccgtgt 108  Q
    |||||||||||||||| || | ||| |||||||| |||||||| |||| | || ||||||||| ||| ||||||    
10577740 ccgacacatataattacactgcattttgtgattttctaaaaaaattagctgtgtcggcgtgtcggtgtccgtgt 10577813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 30 - 68
Target Start/End: Complemental strand, 13997942 - 13997904
Alignment:
30 caacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||||||| || ||||||||||||||    
13997942 caacaccgacacatataattacactgaattatgtgattt 13997904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 20157323 - 20157388
Alignment:
4 gtgtcggacacgtgtcgc-gtccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    |||||||||||| ||||  ||| ||||| |||||||||||||| |||| || ||||||||||||||    
20157323 gtgtcggacacgcgtcggtgtcggacacgacaccgacacatatgattacactgaattatgtgattt 20157388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 27 - 68
Target Start/End: Complemental strand, 34371775 - 34371734
Alignment:
27 acacaacaccgacacatataattataccgaattatgtgattt 68  Q
    |||| ||||||||||||||||||| || ||||||||||||||    
34371775 acacgacaccgacacatataattacactgaattatgtgattt 34371734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 68
Target Start/End: Complemental strand, 2784613 - 2784577
Alignment:
32 acaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||||||||  |||||||||||||    
2784613 acaccgacacatataattatactcaattatgtgattt 2784577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 68
Target Start/End: Complemental strand, 9709877 - 9709841
Alignment:
32 acaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||||| | |||||||||||||||    
9709877 acaccgacacatataattacaacgaattatgtgattt 9709841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 24 - 68
Target Start/End: Complemental strand, 25361951 - 25361907
Alignment:
24 ccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||| |||| |||||||||||||| || ||||||||||||||    
25361951 ccgacacgacactgacacatataattacactgaattatgtgattt 25361907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 24 - 68
Target Start/End: Original strand, 31694704 - 31694748
Alignment:
24 ccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||| |||||||||| | ||||||||| ||||||||||||||    
31694704 ccgacacgacaccgacacttgtaattatactgaattatgtgattt 31694748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 32 - 106
Target Start/End: Complemental strand, 1815314 - 1815240
Alignment:
32 acaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtcagtgcccgt 106  Q
    |||||||||| | |||||| || ||||||||||||||  ||||| | ||| || || ||||||||||||| ||||    
1815314 acaccgacacttgtaattacactgaattatgtgattttttaaaataattatttgtgtcggcgtgtcagtgtccgt 1815240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 25 - 68
Target Start/End: Complemental strand, 5944347 - 5944304
Alignment:
25 cgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    |||||| |||||||||| |||||||| || ||||||||||||||    
5944347 cgacacgacaccgacacttataattacactgaattatgtgattt 5944304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 32 - 71
Target Start/End: Complemental strand, 13436515 - 13436476
Alignment:
32 acaccgacacatataattataccgaattatgtgatttcct 71  Q
    ||||| ||||||||||||| || |||||||||||||||||    
13436515 acaccaacacatataattacactgaattatgtgatttcct 13436476  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 44; Significance: 2e-16; HSPs: 10)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 26 - 108
Target Start/End: Complemental strand, 6401561 - 6401479
Alignment:
26 gacacaacaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtcagtgcccgtgt 108  Q
    ||||| ||||||||||||||||||| || | ||| |||||||| ||||||||||||||| || ||||||||| ||| ||||||    
6401561 gacacgacaccgacacatataattacactgtattttgtgattttctaaaaaatttagttgtgtcggcgtgtcggtgtccgtgt 6401479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.0000000000008
Query Start/End: Original strand, 29 - 82
Target Start/End: Complemental strand, 39758332 - 39758279
Alignment:
29 acaacaccgacacatataattataccgaattatgtgatttcctaaaaaatttag 82  Q
    |||| ||||||||||||||||| || |||||||||||||| |||||||||||||    
39758332 acaataccgacacatataattacactgaattatgtgattttctaaaaaatttag 39758279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 5 - 68
Target Start/End: Original strand, 23015964 - 23016027
Alignment:
5 tgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    |||||||||| ||||| |||||| |||||| |||||| |||||||| || ||||||||||||||    
23015964 tgtcggacacatgtcgtgtccgatacaacatcgacacctataattacactgaattatgtgattt 23016027  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 24 - 97
Target Start/End: Complemental strand, 21814326 - 21814253
Alignment:
24 ccgacacaacaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtc 97  Q
    ||||||| ||||||||||||||||||| || | ||| |||||||| |||||||| |||| | || |||||||||    
21814326 ccgacacgacaccgacacatataattacactgcattttgtgattttctaaaaaaattagctgtgtcggcgtgtc 21814253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 32 - 97
Target Start/End: Original strand, 30099040 - 30099105
Alignment:
32 acaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtc 97  Q
    ||||||||||||||||||| || |||||||| ||||   |||||||||||||| || |||||||||    
30099040 acaccgacacatataattacacagaattatgcgattgtttaaaaaatttagttgtgtcggcgtgtc 30099105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 4 - 64
Target Start/End: Complemental strand, 14873602 - 14873542
Alignment:
4 gtgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtg 64  Q
    |||| |||||||||| ||||||||||  ||||||||||||||||||| ||  |||||||||    
14873602 gtgttggacacgtgttgcgtccgacatgacaccgacacatataattacactaaattatgtg 14873542  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 31084408 - 31084344
Alignment:
4 gtgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||| ||||||||| ||| |||||| | |||||| |  ||||||||||||||    
31084408 gtgtcggacacgtgtcgtgtccgacacgacatcgacacttgtaattacattgaattatgtgattt 31084344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 39205965 - 39205901
Alignment:
4 gtgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||| ||||||||| ||| ||||| ||||| ||||||||||||| ||| |||||| ||||||    
39205965 gtgtcgggcacgtgtcgtgtcggacacgacaccaacacatataattacacctaattatatgattt 39205901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 32 - 82
Target Start/End: Original strand, 32426871 - 32426921
Alignment:
32 acaccgacacatataattataccgaattatgtgatttcctaaaaaatttag 82  Q
    ||||||||||| ||||||| |  |||||||||||||| |||||||||||||    
32426871 acaccgacacaaataattacaatgaattatgtgattttctaaaaaatttag 32426921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 24 - 68
Target Start/End: Original strand, 22423806 - 22423850
Alignment:
24 ccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||| ||||||||| |||||||||||  ||||||||||||||    
22423806 ccgacacgacaccgacatatataattatattgaattatgtgattt 22423850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 41; Significance: 0.00000000000001; HSPs: 22)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000001
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 9778585 - 9778521
Alignment:
4 gtgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||| | ||||||||| |||||||||| | ||||||||| ||||||||||||||    
9778585 gtgtcggacacgtgttgtgtccgacacgacaccgacacttgtaattatactgaattatgtgattt 9778521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 1433539 - 1433475
Alignment:
4 gtgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||| ||||  ||||||||| ||||||||||||||||||| ||| ||| |||||||||    
1433539 gtgtcggacacatgtcttgtccgacacgacaccgacacatataattacaccaaatgatgtgattt 1433475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 5409810 - 5409874
Alignment:
4 gtgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||| ||||||||| |||||||||| | |||||  || ||||||||||||||    
5409810 gtgtcggacacgtgtcgtgtccgacacgacaccgacacttgtaattgcactgaattatgtgattt 5409874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 32093994 - 32094058
Alignment:
4 gtgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||| ||||||||| |||||||||  | |||||| || ||||||||||||||    
32093994 gtgtcggacacgtgtcgtgtccgacacgacaccgacatttgtaattacactgaattatgtgattt 32094058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 32 - 108
Target Start/End: Original strand, 18213035 - 18213112
Alignment:
32 acaccgacacatataattataccgaattatgtgatttcct-aaaaaatttagttttgncggcgtgtcagtgcccgtgt 108  Q
    ||||||||||||||||||| ||  ||||||||||||| || |||||| |||||| || |||||| |||||| ||||||    
18213035 acaccgacacatataattacactaaattatgtgattttctaaaaaaaattagttgtgtcggcgtatcagtgtccgtgt 18213112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 32 - 82
Target Start/End: Complemental strand, 39138501 - 39138451
Alignment:
32 acaccgacacatataattataccgaattatgtgatttcctaaaaaatttag 82  Q
    ||||||||| ||||||||| || |||||||||||||| |||||||||||||    
39138501 acaccgacatatataattacactgaattatgtgattttctaaaaaatttag 39138451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 24 - 68
Target Start/End: Complemental strand, 15902887 - 15902843
Alignment:
24 ccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||||||||||||| ||  |||||||||||||    
15902887 ccgacacaacaccgacacatataattacactaaattatgtgattt 15902843  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 20545220 - 20545267
Alignment:
1 cccgtgtcggacacgtgtcgcgtccgacacaacaccgacacatataat 48  Q
    ||||||||||||| |||||| || |||||| |||||||||||||||||    
20545220 cccgtgtcggacatgtgtcgtgtacgacacgacaccgacacatataat 20545267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 25 - 68
Target Start/End: Original strand, 22602705 - 22602748
Alignment:
25 cgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    |||||| ||||||||||||||||||| || ||||||||||||||    
22602705 cgacacgacaccgacacatataattacactgaattatgtgattt 22602748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 32 - 75
Target Start/End: Complemental strand, 24146873 - 24146830
Alignment:
32 acaccgacacatataattataccgaattatgtgatttcctaaaa 75  Q
    |||||||||||||||||||||  |||||||||||||| ||||||    
24146873 acaccgacacatataattatattgaattatgtgattttctaaaa 24146830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 4 - 50
Target Start/End: Original strand, 21138970 - 21139016
Alignment:
4 gtgtcggacacgtgtcgcgtccgacacaacaccgacacatataatta 50  Q
    ||||||||||||| ||  ||||||||| |||||||||||||||||||    
21138970 gtgtcggacacgtatcatgtccgacacgacaccgacacatataatta 21139016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 22 - 75
Target Start/End: Complemental strand, 7758389 - 7758336
Alignment:
22 gtccgacacaacaccgacacatataattataccgaattatgtgatttcctaaaa 75  Q
    ||||||||| ||||||||||| |||||||||| ||||||| | |||| ||||||    
7758389 gtccgacacgacaccgacacacataattatactgaattatataattttctaaaa 7758336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 68
Target Start/End: Complemental strand, 640170 - 640134
Alignment:
32 acaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||||| || ||||||||||||||    
640170 acaccgacacatataattacactgaattatgtgattt 640134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 68
Target Start/End: Complemental strand, 3721150 - 3721114
Alignment:
32 acaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||||||||  |||||||||||||    
3721150 acaccgacacatataattatactaaattatgtgattt 3721114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 13770776 - 13770712
Alignment:
4 gtgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||| | ||||||||| ||| |||||| | |||||| || ||||||||| ||||    
13770776 gtgtcggacacgtgttgtgtccgacacgacaacgacacttgtaattacactgaattatgtaattt 13770712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 31 - 75
Target Start/End: Complemental strand, 17851489 - 17851445
Alignment:
31 aacaccgacacatataattataccgaattatgtgatttcctaaaa 75  Q
    ||||| |||||||||||||| || |||||||||||||| ||||||    
17851489 aacacagacacatataattacactgaattatgtgattttctaaaa 17851445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 68
Target Start/End: Complemental strand, 19206107 - 19206071
Alignment:
32 acaccgacacatataattataccgaattatgtgattt 68  Q
    |||||||||||||||||||||  ||||||||||||||    
19206107 acaccgacacatataattataatgaattatgtgattt 19206071  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 64
Target Start/End: Original strand, 23849460 - 23849492
Alignment:
32 acaccgacacatataattataccgaattatgtg 64  Q
    |||||||||||||||||||||| ||||||||||    
23849460 acaccgacacatataattatactgaattatgtg 23849492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 24 - 127
Target Start/End: Complemental strand, 32308185 - 32308082
Alignment:
24 ccgacacaacaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtcagtgcccgtgttcatatccgtgcttc 123  Q
    ||||||| |||| |||||||| ||||| || |||||||||||||| || |||   ||||   || ||||||||||||| || ||||| |||  |||||||    
32308185 ccgacacgacactgacacatacaattacactgaattatgtgattttctcaaattattagcggtgtcggcgtgtcagtgtccatgttcgtatttgtgcttc 32308086  T
124 atag 127  Q
    ||||    
32308085 atag 32308082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 43027443 - 43027507
Alignment:
4 gtgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||| ||| ||||| |||||||||| | || ||| || | ||||||||||||    
43027443 gtgtcggacacgtgtcgtgtctgacacgacaccgacacttgtatttacactgcattatgtgattt 43027507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 32 - 75
Target Start/End: Complemental strand, 22484082 - 22484039
Alignment:
32 acaccgacacatataattataccgaattatgtgatttcctaaaa 75  Q
    |||||||||||||||||||||| ||||||||  |||| ||||||    
22484082 acaccgacacatataattatactgaattatgcaattttctaaaa 22484039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 31 - 62
Target Start/End: Complemental strand, 29769511 - 29769480
Alignment:
31 aacaccgacacatataattataccgaattatg 62  Q
    ||||||||||||||||||||||| ||||||||    
29769511 aacaccgacacatataattatacagaattatg 29769480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 40; Significance: 0.00000000000005; HSPs: 14)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 4 - 126
Target Start/End: Complemental strand, 28152178 - 28152062
Alignment:
4 gtgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtcagtgcc 103  Q
    ||||||||||||||||| |||||||||     |||||| | |||||| || ||||||||||||||   |||  ||| || |||| ||||||||||||| |    
28152178 gtgtcggacacgtgtcgtgtccgacac-----cgacacttgtaattacactgaattatgtgatttttcaaattatt-agctttgtcggcgtgtcagtgtc 28152085  T
104 cgtgttcatatccgtgcttcata 126  Q
    ||||| |||||||||||||||||    
28152084 cgtgtccatatccgtgcttcata 28152062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000001
Query Start/End: Original strand, 4 - 94
Target Start/End: Original strand, 17327629 - 17327719
Alignment:
4 gtgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgt 94  Q
    ||||| ||||||||||| ||||||||| |||| |||||||||| ||| ||  ||||||||||||| || ||||  |||||| || ||||||    
17327629 gtgtcagacacgtgtcgtgtccgacacgacactgacacatatagttacactaaattatgtgattttctcaaaatcttagttgtgtcggcgt 17327719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 32 - 101
Target Start/End: Original strand, 5626698 - 5626767
Alignment:
32 acaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtcagtg 101  Q
    ||||||||||||||| ||| || ||| || ||||||| |||||||| |||||| || |||||||||||||    
5626698 acaccgacacatatatttacactgaactaagtgattttctaaaaaaattagttgtgtcggcgtgtcagtg 5626767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 24 - 97
Target Start/End: Original strand, 16488584 - 16488657
Alignment:
24 ccgacacaacaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtc 97  Q
    ||||||| ||||||||||||||||||| || | ||| |||||||| |||||||| |||| | || |||||||||    
16488584 ccgacacgacaccgacacatataattacactgcattttgtgattttctaaaaaaattagctgtgtcggcgtgtc 16488657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 24 - 97
Target Start/End: Complemental strand, 18367901 - 18367828
Alignment:
24 ccgacacaacaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtc 97  Q
    ||||||| ||||||||||||||||||| || | ||| |||||||| |||||||| |||| | || |||||||||    
18367901 ccgacacgacaccgacacatataattacactgcattttgtgattttctaaaaaaattagctgtgtcggcgtgtc 18367828  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 26 - 68
Target Start/End: Original strand, 9025490 - 9025532
Alignment:
26 gacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||| ||||||||||||||||||| || ||||||||||||||    
9025490 gacacgacaccgacacatataattacactgaattatgtgattt 9025532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 24 - 96
Target Start/End: Original strand, 8931596 - 8931668
Alignment:
24 ccgacacaacaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgt 96  Q
    ||||||| ||| |||||||||||||||||| ||||||||| |||| || |||  ||||| | || ||||||||    
8931596 ccgacacgacatcgacacatataattatactgaattatgttattttctcaaatttttagctgtgtcggcgtgt 8931668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 26 - 67
Target Start/End: Complemental strand, 9027241 - 9027200
Alignment:
26 gacacaacaccgacacatataattataccgaattatgtgatt 67  Q
    ||||| ||||||||||||||||||| || |||||||||||||    
9027241 gacacgacaccgacacatataattacacggaattatgtgatt 9027200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 4 - 108
Target Start/End: Complemental strand, 12696409 - 12696305
Alignment:
4 gtgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtcagtgcc 103  Q
    ||||| ||||||||||| ||||||||| |||| ||||| | |||||| || ||||||||| ||||  | |||   |||| | || ||||||||||||| |    
12696409 gtgtcagacacgtgtcgtgtccgacacgacactgacacttgtaattacactgaattatgtaattttttcaaattattagctgtgtcggcgtgtcagtgtc 12696310  T
104 cgtgt 108  Q
    |||||    
12696309 cgtgt 12696305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 68
Target Start/End: Complemental strand, 7027299 - 7027263
Alignment:
32 acaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||||| || ||||||||||||||    
7027299 acaccgacacatataattacactgaattatgtgattt 7027263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 68
Target Start/End: Original strand, 7265595 - 7265631
Alignment:
32 acaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||||| || ||||||||||||||    
7265595 acaccgacacatataattacactgaattatgtgattt 7265631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 24 - 68
Target Start/End: Complemental strand, 9522956 - 9522912
Alignment:
24 ccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    |||||||||||||||||| | |||||| || ||||||||||||||    
9522956 ccgacacaacaccgacacttgtaattacactgaattatgtgattt 9522912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 24 - 68
Target Start/End: Original strand, 11424705 - 11424749
Alignment:
24 ccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||| |||||||||||||||  ||||||| ||||||    
11424705 ccgacacaacaccaacacatataattatattgaattatatgattt 11424749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 24 - 68
Target Start/End: Complemental strand, 26562754 - 26562710
Alignment:
24 ccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||| ||| ||||||||||||||| || ||||||||||||||    
26562754 ccgacacgacatcgacacatataattacactgaattatgtgattt 26562710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 35; Significance: 0.00000000005; HSPs: 9)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 27 - 77
Target Start/End: Original strand, 44132641 - 44132691
Alignment:
27 acacaacaccgacacatataattataccgaattatgtgatttcctaaaaaa 77  Q
    |||| |||||||||||||||||||||| |||||| ||||||| ||||||||    
44132641 acacgacaccgacacatataattatactgaattacgtgattttctaaaaaa 44132691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 19 - 68
Target Start/End: Original strand, 15659749 - 15659798
Alignment:
19 cgcgtccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    |||||||||||| ||||| ||||||||||||| ||||||||||| |||||    
15659749 cgcgtccgacacgacaccaacacatataattacaccgaattatgagattt 15659798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 3947740 - 3947804
Alignment:
4 gtgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||| ||||||||| |||| ||||| | |||||| || |||||||| |||||    
3947740 gtgtcggacacgtgtcgtgtccgacacgacactgacacttgtaattacactgaattatgcgattt 3947804  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 26 - 108
Target Start/End: Original strand, 5414168 - 5414250
Alignment:
26 gacacaacaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtcagtgcccgtgt 108  Q
    ||||| ||||||| ||||||||||| || | ||| |||||||| |||||||| |||| | || ||||||||| ||| ||||||    
5414168 gacacgacaccgatacatataattacactgcattttgtgattttctaaaaaaattagctgtgtcggcgtgtccgtgtccgtgt 5414250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 32 - 77
Target Start/End: Original strand, 19097896 - 19097941
Alignment:
32 acaccgacacatataattataccgaattatgtgatttcctaaaaaa 77  Q
    ||||||||| |||||||||||| |||||| ||||||| ||||||||    
19097896 acaccgacaaatataattatactgaattacgtgattttctaaaaaa 19097941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 68
Target Start/End: Complemental strand, 9996897 - 9996861
Alignment:
32 acaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||| |||||||||||||| ||||||||||||||    
9996897 acaccgagacatataattatactgaattatgtgattt 9996861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 68
Target Start/End: Original strand, 18576039 - 18576075
Alignment:
32 acaccgacacatataattataccgaattatgtgattt 68  Q
    ||||| ||||||||||||| |||||||||||||||||    
18576039 acaccaacacatataattacaccgaattatgtgattt 18576075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 24 - 68
Target Start/End: Original strand, 22234884 - 22234928
Alignment:
24 ccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||| ||||||||||||| ||||| || ||||||||||||||    
22234884 ccgacacgacaccgacacatagaattacactgaattatgtgattt 22234928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 4 - 68
Target Start/End: Original strand, 23292965 - 23293024
Alignment:
4 gtgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||| |||||||||     |||||| | ||||||||| ||||||||||||||    
23292965 gtgtcggacacgtgtcgtgtccgacac-----cgacacttgtaattatactgaattatgtgattt 23293024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.00000000005; HSPs: 9)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000005
Query Start/End: Original strand, 32 - 97
Target Start/End: Complemental strand, 35222995 - 35222930
Alignment:
32 acaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtc 97  Q
    ||||||||||||||||||| |  |||||||||||||| |||||||  |||||| || |||||||||    
35222995 acaccgacacatataattacattgaattatgtgattttctaaaaatgttagttgtgtcggcgtgtc 35222930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 27505331 - 27505267
Alignment:
4 gtgtcggacacgtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||| ||| ||||| |||||||||| | |||||| ||  |||||||||||||    
27505331 gtgtcggacacgtgtcgtgtcagacacgacaccgacacttgtaattacacttaattatgtgattt 27505267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 32 - 81
Target Start/End: Original strand, 13845527 - 13845576
Alignment:
32 acaccgacacatataattataccgaattatgtgatttcctaaaaaattta 81  Q
    ||||||||||||||||||| || | ||| |||||||| ||||||||||||    
13845527 acaccgacacatataattacactgcattttgtgattttctaaaaaattta 13845576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 4 - 68
Target Start/End: Complemental strand, 29508530 - 29508465
Alignment:
4 gtgtcggacacgtgtcgcgtccgacac-aacaccgacacatataattataccgaattatgtgattt 68  Q
    |||||||||  |||||| ||||||||| |||| ||||||||||||||| || ||||||| ||||||    
29508530 gtgtcggacgtgtgtcgtgtccgacaccaacatcgacacatataattacactgaattatatgattt 29508465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 68
Target Start/End: Original strand, 7614417 - 7614453
Alignment:
32 acaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||| |||||||||||| ||||||||||||||    
7614417 acaccgacatatataattatactgaattatgtgattt 7614453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 68
Target Start/End: Complemental strand, 7928507 - 7928471
Alignment:
32 acaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||||| || ||||||||||||||    
7928507 acaccgacacatataattacactgaattatgtgattt 7928471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 68
Target Start/End: Original strand, 8789552 - 8789588
Alignment:
32 acaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||||| || ||||||||||||||    
8789552 acaccgacacatataattacacggaattatgtgattt 8789588  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 68
Target Start/End: Complemental strand, 18427006 - 18426970
Alignment:
32 acaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||| ||||||||| |||||||||||||||||    
18427006 acaccgacatatataattacaccgaattatgtgattt 18426970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 68
Target Start/End: Original strand, 40993337 - 40993373
Alignment:
32 acaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||||| || ||||||||||||||    
40993337 acaccgacacatataattacactgaattatgtgattt 40993373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0171 (Bit Score: 34; Significance: 0.0000000002; HSPs: 1)
Name: scaffold0171
Description:

Target: scaffold0171; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 68
Target Start/End: Complemental strand, 23494 - 23441
Alignment:
15 gtgtcgcgtccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    |||||| ||||||||| |||||||||| |||||||| || ||||||||||||||    
23494 gtgtcgtgtccgacacgacaccgacacttataattacactgaattatgtgattt 23441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0168 (Bit Score: 33; Significance: 0.0000000007; HSPs: 1)
Name: scaffold0168
Description:

Target: scaffold0168; HSP #1
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 24 - 68
Target Start/End: Complemental strand, 21108 - 21064
Alignment:
24 ccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||| | ||||||||||||||||||||||| |||||||||||    
21108 ccgacacgataccgacacatataattataccgacttatgtgattt 21064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.0000000007; HSPs: 11)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 32 - 127
Target Start/End: Complemental strand, 14134756 - 14134661
Alignment:
32 acaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtcagtgcccgtgttcatatccgtgcttcatag 127  Q
    ||||||||| ||||||||| || |||||||||||||| || |||   ||||| ||| || |||||| ||| | |||| | ||||||||||||||||    
14134756 acaccgacatatataattacactgaattatgtgattttctcaaattattagtattgtcgacgtgtccgtgtcggtgtccgtatccgtgcttcatag 14134661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.0000000007
Query Start/End: Original strand, 32 - 84
Target Start/End: Complemental strand, 18964234 - 18964182
Alignment:
32 acaccgacacatataattataccgaattatgtgatttcctaaaaaatttagtt 84  Q
    ||||||||||||||||||| |  |||||||||||||| |||||||| ||||||    
18964234 acaccgacacatataattacattgaattatgtgattttctaaaaaaattagtt 18964182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000003
Query Start/End: Original strand, 25 - 68
Target Start/End: Original strand, 21520763 - 21520806
Alignment:
25 cgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    |||||| ||||||||||||||||||||| |||||||| ||||||    
21520763 cgacacgacaccgacacatataattatatcgaattatatgattt 21520806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 27 - 68
Target Start/End: Complemental strand, 11803321 - 11803280
Alignment:
27 acacaacaccgacacatataattataccgaattatgtgattt 68  Q
    |||||||||| ||||||||||||| || ||||||||||||||    
11803321 acacaacaccaacacatataattacactgaattatgtgattt 11803280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 27 - 68
Target Start/End: Original strand, 11927083 - 11927124
Alignment:
27 acacaacaccgacacatataattataccgaattatgtgattt 68  Q
    |||| ||||||||||||||||||| || ||||||||||||||    
11927083 acacgacaccgacacatataattacactgaattatgtgattt 11927124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 79 - 127
Target Start/End: Original strand, 36450803 - 36450851
Alignment:
79 ttagttttgncggcgtgtcagtgcccgtgttcatatccgtgcttcatag 127  Q
    |||||| || ||||||||||||| |||||| | ||||||||||||||||    
36450803 ttagttgtgtcggcgtgtcagtgtccgtgtccgtatccgtgcttcatag 36450851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 68
Target Start/End: Original strand, 4786340 - 4786376
Alignment:
32 acaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||||| || ||||||||||||||    
4786340 acaccgacacatataattacactgaattatgtgattt 4786376  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 68
Target Start/End: Complemental strand, 8847313 - 8847277
Alignment:
32 acaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||||| || ||||||||||||||    
8847313 acaccgacacatataattacactgaattatgtgattt 8847277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 32 - 68
Target Start/End: Original strand, 26902177 - 26902213
Alignment:
32 acaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||||||||||||||| || ||||||||||||||    
26902177 acaccgacacatataattacactgaattatgtgattt 26902213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 25 - 108
Target Start/End: Original strand, 34451032 - 34451115
Alignment:
25 cgacacaacaccgacacatataattataccgaattatgtgatttcctaaaaaatttagttttgncggcgtgtcagtgcccgtgt 108  Q
    |||||| ||||||||||||||||||| || | ||| |||||||| | |||||| |||| | || | | ||||| ||||||||||    
34451032 cgacacgacaccgacacatataattacactgcattttgtgattttcaaaaaaaattagctgtgtcagtgtgtcggtgcccgtgt 34451115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 89 - 128
Target Start/End: Original strand, 31109577 - 31109616
Alignment:
89 cggcgtgtcagtgcccgtgttcatatccgtgcttcataga 128  Q
    ||||||||||||| |||||| |||||| ||||||||||||    
31109577 cggcgtgtcagtgtccgtgtccatatcagtgcttcataga 31109616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0020 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: scaffold0020
Description:

Target: scaffold0020; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 26 - 68
Target Start/End: Original strand, 135308 - 135350
Alignment:
26 gacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||| ||||||||||||||||||| || ||||||||||||||    
135308 gacacgacaccgacacatataattacacagaattatgtgattt 135350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0123 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: scaffold0123
Description:

Target: scaffold0123; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 24 - 68
Target Start/End: Original strand, 44519 - 44563
Alignment:
24 ccgacacaacaccgacacatataattataccgaattatgtgattt 68  Q
    ||||||| | ||||||||||||||||| || ||||||||||||||    
44519 ccgacacgataccgacacatataattacactgaattatgtgattt 44563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 175954 times since January 2019
Visitors: 1577