View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 108_7_64 (Length: 250)

Name: 108_7_64
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 108_7_64
108_7_64
[»] chr1 (1 HSPs)
chr1 (1-222)||(32898313-32898535)


Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 32898313 - 32898535
Alignment:
1 agatatatgtattacgttacgtacctaatttt-tgtttgaaaatgaaagatagaataaaaattaatacatggtcaaagttaggaaaaatagtatcgaatt 99  Q
    |||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
32898313 agatatatgtattatgttacgtacctaattttttgtttgaaaatgaaagatagaataaaaattaatacatggtcaaagttaggaaaaatagtctcgaatt 32898412  T
100 gccttagatggnttgaagctgacaatagtccataataagtagtttctagaattttcaaaagaataaaagtacntgtttcctttatttcaaaatacttgtt 199  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
32898413 gccttagatggtttgaagctgacaatagtccataataagtagtttctagaattttcaaaagaataaaagtacatgtttcctttatttcaaaatacttgtt 32898512  T
200 acaattttataatatatagtgtt 222  Q
    |||||||||||||||||||||||    
32898513 acaattttataatatatagtgtt 32898535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Noble Research Institute, LLC

This website was viewed 108070 times since January 2019
Visitors: 1329